Method and kit for detecting mononucleotide polymorphic site rs 3820189 of high blood pressure susceptibility gene Mfn2
A technology of gene polymorphism and detection method, applied in the field of detection of this SNP locus, can solve the problem of uncertainty of EH function, and achieve the effects of low cost, simple diagnosis and treatment, and simple and easy method.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Example 1 Fluorescent PCR detection
[0035] 1. Experimental materials
[0036] The 7900HT fluorescent quantitative PCR instrument was purchased from ABI Company in the United States, and the polymerase chain reaction solution (TaqMan EXPress Master Mix) was custom-synthesized by Applied Biosystems (ABI).
[0037] 2. Primer and probe design and synthesis:
[0038] Using the partial sequence of the 5' guide sequence of the MFn2 gene as a template, the TaqMan primers and probe sites were analyzed using Primer ExpressTM 2.0 software, and custom-synthesized by Applied Biosystems (ABI).
[0039]
[0040] Primers for detection:
[0041] MFn2 gene rs3820189 upstream primer sequence: 5'- CCACAGTCCACAGTCAGACC-3'
[0042] MFn2 gene rs3820189 downstream primer sequence: 5'- TCAAGTAATCCTCCCCACCTC -3'
[0043] Fluorescent probes:
[0044] MFn2 gene rs3820189 fluorescent probe 1: 5'-VIC-atgctgacCacatgttgaag-TAMRA-3'
[0045] MFn2 gene rs3820189 fluorescent probe 2: 5'-FAM-atgc...
Embodiment 2
[0059] The rs3820189 site of the essential hypertension susceptibility gene MFn2 gene was detected by sequencing. 10 cases of each of the above-mentioned hypertension cases and control groups were selected for sequencing to determine the genotype of rs3820189.
[0060]
[0061] 1. Experimental method
[0062] The above-mentioned fluorescent PCR primers were still used as primers for PCR sequencing, and the amplified products were directly sequenced after purification. The sequencing instrument is ABI's 3130xl genetic analyzer, which is analyzed with sequence analysis 5.2 analysis software, and the results can also be viewed with chromas.
[0063]
[0064] 2. Experimental results
[0065] The screenshot of the sequencing result is as follows: figure 2 shown.
[0066] In the end, the sequencing results of 20 cases were completely consistent with the genotype analysis results of 7900 fluorescent PCR.
[0067]
[0068] 3. Association analysis of MFn2 gene rs3820189 genoty...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 