Method and kit for detecting mononucleotide polymorphic site rs 3820189 of high blood pressure susceptibility gene Mfn2

A technology of gene polymorphism and detection method, applied in the field of detection of this SNP locus, can solve the problem of uncertainty of EH function, and achieve the effects of low cost, simple diagnosis and treatment, and simple and easy method.

Inactive Publication Date: 2012-07-18
BEIJING ANZHEN HOSPITAL AFFILIATED TO CAPITAL MEDICAL UNIV +1
View PDF3 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the effect of Mfn2 on EH is still uncertain

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method and kit for detecting mononucleotide polymorphic site rs 3820189 of high blood pressure susceptibility gene Mfn2
  • Method and kit for detecting mononucleotide polymorphic site rs 3820189 of high blood pressure susceptibility gene Mfn2
  • Method and kit for detecting mononucleotide polymorphic site rs 3820189 of high blood pressure susceptibility gene Mfn2

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1 Fluorescent PCR detection

[0035] 1. Experimental materials

[0036] The 7900HT fluorescent quantitative PCR instrument was purchased from ABI Company in the United States, and the polymerase chain reaction solution (TaqMan EXPress Master Mix) was custom-synthesized by Applied Biosystems (ABI).

[0037] 2. Primer and probe design and synthesis:

[0038] Using the partial sequence of the 5' guide sequence of the MFn2 gene as a template, the TaqMan primers and probe sites were analyzed using Primer ExpressTM 2.0 software, and custom-synthesized by Applied Biosystems (ABI).

[0039]

[0040] Primers for detection:

[0041] MFn2 gene rs3820189 upstream primer sequence: 5'- CCACAGTCCACAGTCAGACC-3'

[0042] MFn2 gene rs3820189 downstream primer sequence: 5'- TCAAGTAATCCTCCCCACCTC -3'

[0043] Fluorescent probes:

[0044] MFn2 gene rs3820189 fluorescent probe 1: 5'-VIC-atgctgacCacatgttgaag-TAMRA-3'

[0045] MFn2 gene rs3820189 fluorescent probe 2: 5'-FAM-atgc...

Embodiment 2

[0059] The rs3820189 site of the essential hypertension susceptibility gene MFn2 gene was detected by sequencing. 10 cases of each of the above-mentioned hypertension cases and control groups were selected for sequencing to determine the genotype of rs3820189.

[0060]

[0061] 1. Experimental method

[0062] The above-mentioned fluorescent PCR primers were still used as primers for PCR sequencing, and the amplified products were directly sequenced after purification. The sequencing instrument is ABI's 3130xl genetic analyzer, which is analyzed with sequence analysis 5.2 analysis software, and the results can also be viewed with chromas.

[0063]

[0064] 2. Experimental results

[0065] The screenshot of the sequencing result is as follows: figure 2 shown.

[0066] In the end, the sequencing results of 20 cases were completely consistent with the genotype analysis results of 7900 fluorescent PCR.

[0067]

[0068] 3. Association analysis of MFn2 gene rs3820189 genoty...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the fields of molecular biology and medicine, and relates to a method and a kit for detecting the polymorphic site of high blood pressure susceptibility gene. The invention provides the method for detecting the polymorphic site of the high blood pressure susceptibility gene, which comprises the following step of detecting the gene type of human mitofusin gene 2 (Mfn2) rs3820189 site, wherein the rs3820189 is provided with an individual of T gene type, and the susceptibility of the high blood pressure is obviously higher than common crowd. The invention further discloses a corresponding detection kit which comprises a primer amplifying the rs3820189 site, and a primer amplifying a region of Mfn2 gene 5' guide sequence, comprising the rs3820189 site. The method is used for detecting the gene type of the rs3820189 site, and is simple and practical, quick and high-efficiency, and lower in cost, so that a simple new way for diagnosing and treating the high blood pressure is provided.

Description

technical field [0001] The present invention relates to the fields of molecular biology and medicine. More specifically, it involves detection of the (single nucleotide polymorphism, SNP) site rs3820189 of human mitochondrial fusion gene 2 (Mfn2) and its correlation with essential hypertension. The invention also relates to a method and a kit for detecting the SNP site. Background technique [0002] Essential hypertension (essential hypertension, EH) is a multifactorial and polygenic disease. It is a common and frequent cardiovascular disease caused by environmental and genetic factors, which has a great impact on human health. With the development of molecular medicine, more than 150 hypertension-related genes have been discovered, but the pathogenesis of EH is still not completely clear, and the early diagnosis and prevention of hypertension have not been fully resolved. EH is the result of the joint action of genetic factors and the environment, and 30%-60% of changes i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
Inventor 温绍君李瑶曾清吴海刘洁琳刘雅王佐广楼煜清刘阔牛秋丽顾伟
Owner BEIJING ANZHEN HOSPITAL AFFILIATED TO CAPITAL MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap