Noninvasive detection kit for susceptibility genes for oral cancer
A technology for detecting kits and susceptibility genes, applied in the field of molecular biology, can solve problems such as increased risk of cancer, danger, and cancer
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] Example 1. Use of detection kits
[0022] 1. Extract DNA template
[0023] The epithelial cells of the oral mucosa of the subjects were scraped, and the genomic DNA was extracted by the phenol-chloroform method.
[0024] 2. PCR amplification reaction
[0025] Use the PCR reaction component in the detection kit, which contains the following primer pairs:
[0026] (1) CYP1A1 (Ile462Val) forward primer: 5'CTTGCCTGTCCTTCTATCCTTTG 3'
[0027] CYP1A1 (Ile462Val) reverse primer: 5'CAGGCTGAACCTTAGACCACA 3'
[0028] (2) CYP1A1 (MspI) forward primer: 5'GGGAGGAAGAAGAGGAGGTAG 3'
[0029] CYP1A1 (MspI) reverse primer: 5'CTTCACTCCCACCGCCTCT3'
[0030] (3) CYP2D6 (C188T) forward primer: 5'AACACAGCAGGTTCACTCACAG3'
[0031] CYP2D6 (C188T) reverse primer: 5'ATCCATGTTTGCTTCTGGTAGG3'
[0032] The reaction system for PCR amplification is: 10×PCR reaction buffer 2.5μl 25mM dNTP mixture 0.2μl, 5U / ul Taq enzyme 0.125μl, DNA template 1μl (about 12-15ng), 20uM forward primer and reverse p...
Embodiment 2
[0046] Example 2. The service of non-invasive detection of genes for the prevention of oral cancer
[0047] 1. Sampling and DNA extraction
[0048] The physicians in the laboratory department of the hospital instructed the subjects to use oral swabs to sample oral epithelial cells, and the phenol-chloroform method was used to extract DNA from oral epithelial cells.
[0049] 2. Genotype detection
[0050] Using the kit provided by the present invention, the Ile462Val site polymorphism and the MspI site polymorphism on the CYP1A1 gene of the subject's genomic DNA, the three single nucleotide polymorphisms of the C188T site polymorphism on the CYP2D6 gene The genotypes of the three SNPs were determined by DNA sequencing.
[0051] 3. Risk assessment of oral cancer high-risk groups
[0052] Through the analysis of the SNPs genotypes of the subjects, a risk assessment and analysis report of oral cancer susceptibility genes is issued. The report details the polymorphism of the Il...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com