Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Noninvasive detection kit for susceptibility genes for oral cancer

A technology for detecting kits and susceptibility genes, applied in the field of molecular biology, can solve problems such as increased risk of cancer, danger, and cancer

Inactive Publication Date: 2012-07-25
解码(上海)生物医药科技有限公司
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Activated CYP1A1 can convert organic substances in a variety of environments, such as polycyclic aromatic hydrocarbons, into cytotoxins or other carcinogens, thereby increasing the risk of cancer
Molecular biology studies have shown that the 462nd amino acid of CYP1A1 changes from Ile to Val, and the CYP1A1 MSPI site T→C will increase the enzyme activity of CYP1A1, which can produce highly inducible CYP1A1 enzymes and accelerate the activation rate of polycyclic aromatic hydrocarbons , leading to an increased risk of various cancers

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Noninvasive detection kit for susceptibility genes for oral cancer
  • Noninvasive detection kit for susceptibility genes for oral cancer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Example 1. Use of detection kits

[0022] 1. Extract DNA template

[0023] The epithelial cells of the oral mucosa of the subjects were scraped, and the genomic DNA was extracted by the phenol-chloroform method.

[0024] 2. PCR amplification reaction

[0025] Use the PCR reaction component in the detection kit, which contains the following primer pairs:

[0026] (1) CYP1A1 (Ile462Val) forward primer: 5'CTTGCCTGTCCTTCTATCCTTTG 3'

[0027] CYP1A1 (Ile462Val) reverse primer: 5'CAGGCTGAACCTTAGACCACA 3'

[0028] (2) CYP1A1 (MspI) forward primer: 5'GGGAGGAAGAAGAGGAGGTAG 3'

[0029] CYP1A1 (MspI) reverse primer: 5'CTTCACTCCCACCGCCTCT3'

[0030] (3) CYP2D6 (C188T) forward primer: 5'AACACAGCAGGTTCACTCACAG3'

[0031] CYP2D6 (C188T) reverse primer: 5'ATCCATGTTTGCTTCTGGTAGG3'

[0032] The reaction system for PCR amplification is: 10×PCR reaction buffer 2.5μl 25mM dNTP mixture 0.2μl, 5U / ul Taq enzyme 0.125μl, DNA template 1μl (about 12-15ng), 20uM forward primer and reverse p...

Embodiment 2

[0046] Example 2. The service of non-invasive detection of genes for the prevention of oral cancer

[0047] 1. Sampling and DNA extraction

[0048] The physicians in the laboratory department of the hospital instructed the subjects to use oral swabs to sample oral epithelial cells, and the phenol-chloroform method was used to extract DNA from oral epithelial cells.

[0049] 2. Genotype detection

[0050] Using the kit provided by the present invention, the Ile462Val site polymorphism and the MspI site polymorphism on the CYP1A1 gene of the subject's genomic DNA, the three single nucleotide polymorphisms of the C188T site polymorphism on the CYP2D6 gene The genotypes of the three SNPs were determined by DNA sequencing.

[0051] 3. Risk assessment of oral cancer high-risk groups

[0052] Through the analysis of the SNPs genotypes of the subjects, a risk assessment and analysis report of oral cancer susceptibility genes is issued. The report details the polymorphism of the Il...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a noninvasive detection kit for susceptibility genes for oral cancer. The kit comprises specific primers, DNA (deoxyribonucleic acid) sequencing primers, PCR (polymerase chain reaction) components, PCR product purification components, DNA sequencing reaction components and the like for detecting genotypes of three single nucleotide polymorphism (SNP) sites, including Ile462Val site polymorphism and MspI site polymorphism on CYP1A1 (cytochrome P4501A1) gene and C188T site polymorphism on CYP2D6 (cytochrome P450 2D6) gene. According to the invention, genotypes of three single nucleotide polymorphism sites closely related with oral cancer occurrence are detected by the kit, so as to estimate the risk level of the oral cancer of a subject, and finally the subject is instructed to specifically prevent occurrence of oral cancer at a genetic level according to a gene detection result of each subject, so as to lower the morbidity of oral cancer. The sampling method disclosed by the invention is oral mucosa sampling; the process is painless and non-invasive; and cross infection can be avoided.

Description

technical field [0001] The invention belongs to the field of molecular biology, relates to medicine and biotechnology, and specifically relates to a detection kit for oral cancer susceptibility genes, which evaluates the risk level of oral cancer from the genetic level according to the detection results, and serves as a direction for the prevention and treatment of oral cancer guide. Background technique [0002] Oral cancer is a general term for malignant tumors that occur in the oral cavity, most of which are squamous cell carcinomas. In clinical practice, oral cancer includes lip cancer, gum cancer, tongue cancer, soft and hard palate cancer, jaw cancer, mouth floor cancer, oropharyngeal cancer, salivary gland cancer and maxillary sinus cancer, as well as cancers that occur in the skin and mucous membranes of the face. Oral cancer is one of the most common malignant tumors of the head and neck. [0003] Oral cancer is the sixth most common tumor in the world, and the in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
Inventor 潘加奎姜丽
Owner 解码(上海)生物医药科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com