Ribonucleic acid interference (RNAi) for inhibiting porcine reproduction and respiratory syndrome virus replication and preparation method of RNAi

A technology for respiratory syndrome and virus replication, used in DNA preparation, botanical equipment and methods, biochemical equipment and methods, etc.

Active Publication Date: 2012-09-12
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF0 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are still many questions about RNAi to be resolved, such as: the time and target site of RNAi; the interferon response in mammals; the exact mechanism of RNAi; off-target effects, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Ribonucleic acid interference (RNAi) for inhibiting porcine reproduction and respiratory syndrome virus replication and preparation method of RNAi
  • Ribonucleic acid interference (RNAi) for inhibiting porcine reproduction and respiratory syndrome virus replication and preparation method of RNAi
  • Ribonucleic acid interference (RNAi) for inhibiting porcine reproduction and respiratory syndrome virus replication and preparation method of RNAi

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] 1. Generation of ds oligo expressing shRNA

[0049] With the help of the online design software (BLOCK-iT) of Invitrogen Company of the United States TM RNAi Designer), determine the DNA insertion sequence corresponding to the specific shRNA fragment 875 and 1010 required by the pEN / U6 vector, and send it to Yubao Bioengineering (Dalian) Co., Ltd. for synthesis and annealing to generate ds oligo. The insertion sequence is as follows:

[0050] 875: 5'→3'

[0051] SEQ ID NO. 1: TCACCGGAACAGGTTTCCAACCAAGGCGAA

[0052] CCTTGGTTGGAAACCTGTTCC

[0053] SEQ ID NO. 2: B AAAAGGAACAGGTTTCCAACCAAGGTTCG

[0054] CCTTGGTTGGAAACCTGTTCC

[0055] 1010: 5'→3'

[0056] SEQ ID NO. 3: T CACCGGACAATACTTGGCACCAATACGAA

[0057] TATTGGTGGCAAGTATTGTCC

[0058] SEQ ID NO. 4: B AAAAGGACAATACTTGGCACCAATATTCG

[0059] 2. ds oligo is connected with pEN / U6 vector to construct pEN / U6-shRNA

[0060] Connection reaction system:

[0061] 2.1 Generation of double-stranded oligonu...

Embodiment 2

[0094] 1-6 steps are the same as in Example 1.

[0095] 7. Preparation of sample 2

[0096] (1) Construction of expression plasmid pEGFP+ Nsp9

[0097] In order to verify the ability of Marc-145 cells expressing shRNA to inhibit target genes, eukaryotic expression vectors containing GFP and Nsp9 genes were constructed in this study. The specific construction method is as follows:

[0098] The amplified Nsp9 gene and pEGFP-N1 empty vector were digested with BamH I and XhoI respectively and recovered, then ligated with T4 DNA ligase at 16°C for 3 hours, transformed into competent E.coli JM109, and used 50 μg / mL card Namycin-resistant LB plates were screened, and positive recombinant plasmids were obtained after identification by PCR and BamH I and Xho I double enzyme digestion. The recombinant plasmid with correct sequence and reading frame was named pEGFP+Nsp9.

[0099] (2) Transfection of Marc-145 cells with recombinant plasmid pEGFP+ Nsp9

[0100] Culture Marc-145 cells ...

Embodiment 3

[0106] 1-7 steps are with embodiment 1.

[0107] 8. TCID50 to measure the antiviral effect of shRNA

[0108] Get 1 part by the PRRSV cytotoxicity that step 7 cultivates among the implementation case 1, do ten times ratio dilution continuously (10 -1 ~10 -11 ), add 100 μL of virus solution of each dilution in each well, make 8 replicate wells for each dilution, add maintenance solution in the 12th column as a negative control, and measure TCID50 as follows:

[0109] 8.1 Use DMEM containing 10% calf serum to pass the well-grown Marc-145 cells to a 96-well culture plate, and place them in a cell culture incubator until the bottom of the well is covered.

[0110] 8.2 Aspirate the culture medium in the cell wells, rinse twice with serum-free DMEM, then add 100 μL of virus solution of each dilution to each well, absorb at 37°C for 1 hour, discard the virus dilution solution, and wash with serum-free DMEM Rinse twice, add 100 μL DMEM containing only 1% double antibody to continue ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses ribonucleic acid interference (RNAi) for inhibiting porcine reproductiion and respiratory syndrome virus (PRRSV) replication and a preparation method of RNAi, The RNAi comprises a small interfering RNA (siRNA) sequence. The preparation method comprises the steps of constructing a short hairpin RNA (shRNA) slow virus expression vector, preparing replication-defective slow virus, infecting slow virus Marc-145 cells (green monkey kidney cells) and the like. The invention also discloses a method for verifying the effect of inhibiting PRRSV from replication. The RNAi sequence has the obvious effect of inhibiting the PRRSV replication on sensitive cells. According to the invention, the exploration of RNA interference on in vitro and vivo replication of hog cholera virus is carried out, a slow-virtue-mediated stably-integrated RNA interfering technology for special conserved gene segments of a targeted hog cholera virus genome is constructed, and transgenic animals with the siRNA of targeted hog PRRSV are hopeful to construct. The necessary experimental data is accumulated for gene function research of RNAi applied to PRRSV and prevention and treatment of hog cholera, and early-stage preparation is provided for disease resistance breeding of animals.

Description

technical field [0001] The invention relates to the technical field of prevention and control of porcine reproductive and respiratory syndrome virus (PRRSV). It consists of two pairs of shRNA sequences that inhibit PRRSV replication and is used for inhibiting PRRSV replication. The invention also includes a preparation method for RNAi. Background technique [0002] Porcine reproductive and respiratory syndrome (PRRS), also known as blue ear disease, caused by porcine reproductive and respiratory syndrome virus (porcine reproductive and respiratory syndrome virus, PRRSV), is a serious hazard to the pig industry The contagious infectious disease, PRRSV has European type and American type virus. All belong to the genus Arterivirus of the Coronaviridae family, and are RNA (ribonucleic acid) viruses with envelopes that are 20-hedron or spherical. The "highly pathogenic porcine blue ear disease" that broke out in the summer and autumn of 2006 caused huge economic losses to the pi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/867C12N7/04C12N5/07C12N15/10
Inventor刘湘涛吴锦艳田宏陈妍尚佑军尹双辉王光祥靳野张克山杨顺利刘永杰
OwnerLANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI