Multi-gene plant expression vector and construction method as well as application thereof
A plant expression carrier and gene expression technology, applied in the field of plant expression vectors, can solve the problems of small number of genes carried by the carrier, high cost of special strains, cumbersome steps, etc., and achieve the effects of reducing the difficulty of experiments, facilitating promotion, and simplifying operation steps
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Example 1 Construction of cloning vector p6435x
[0041] 1. Synthesis of vector p1302x
[0042] Use 26# primer:
[0043] FAGATCTCCACTTCTAAAATGGCTACAGGCATCGTGGTGT (SEQ ID No. 1)
[0044] R GGTGACCCCACTTCTAAAATGGATTTTGCCTTCCTGTTTT (SEQ ID No. 2)
[0045] Using pUC18 as a template, PCR amplification was performed to obtain a fragment of about 500 bp, which was ligated into pUCm-T to synthesize vector p26; p26 and pCAMBIA1302 were double digested with BglII and BstEII, respectively. The small fragment of p26 and the large fragment of pCAMBIA1302 were recovered and ligated. Synthetic vector p1302x.
[0046] 2. Synthesis of vector p1302x30
[0047] Use 30# primer:
[0048] F aagcttagatctCTTGGATCAGATTGTCGT (SEQ ID No. 3)
[0049] R ggatccAGAGTCCCCCGTGTTCT (SEQ ID No. 4)
[0050] Using pCAMBIA1302 as a template, PCR amplification was performed to obtain a fragment of 597 bp, which was ligated into pUCm-T to synthesize vector p30. p30 and p1302x were double digested wit...
Embodiment 2
[0073] Example 2 Construction of transformation vector p209
[0074] 1. Synthesis of vector p88
[0075] Use 88# primer:
[0076] F gaattctctagaCTTCGGTTTCCGTGTT (SEQ ID No. 13)
[0077] RaagctTGATGCCTCCGTGTAA (SEQ ID No. 14)
[0078] PCR amplification was performed using pET28a as a template to obtain a fragment of about 300 bp in length. This fragment was ligated into pUCm-T to synthesize vector p88.
[0079] 2. Synthesis of plant transformation vector p209
[0080] p88 and pBI121 were double digested with HindIII and EcoRI, respectively. The small fragment of p88 and the large fragment of pBI121 were recovered and ligated to synthesize the plant transformation vector p209.
Embodiment 3
[0081] Embodiment 3 Construction of plant transformation vector carrying two insecticidal and toxic protein genes of BtCryIA and BtCryIIIA
[0082] 1. Construction of plant transformation vector p2096871
[0083] A general PCR reaction system was used, and the insecticidal toxin gene BtCryIA gene and BtCryIIIA gene were used as templates for PCR; PCR reaction procedures were as follows: pre-denaturation at 94°C for 10 min, denaturation at 94°C for 30s, annealing at 48-60°C for 40s, and extension at 72°C 1.5min, 20 cycles; 72°C extension for 20min. After the reaction, the presence or absence and length of the amplified product fragments were detected by 1% TAE agarose gel electrophoresis, and the gel was cut and the appropriate fragments were recovered using a gel recovery kit. The primers are shown in Table 1.
[0084] Table 1 Partial primers
[0085]
[0086]
[0087] Extract the p6435x plasmid, use the restriction endonuclease Eam1105I respectively, use a 50 μL enzym...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com