Unlock instant, AI-driven research and patent intelligence for your innovation.

Multi-gene plant expression vector and construction method as well as application thereof

A plant expression carrier and gene expression technology, applied in the field of plant expression vectors, can solve the problems of small number of genes carried by the carrier, high cost of special strains, cumbersome steps, etc., and achieve the effects of reducing the difficulty of experiments, facilitating promotion, and simplifying operation steps

Inactive Publication Date: 2012-10-03
HEBEI AGRICULTURAL UNIV.
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the past, the construction of multi-gene expression vectors was limited by restriction enzyme cutting sites, and the number of genes carried by the vectors was small. In some construction processes, dephosphorylation, phosphorylation, sticky end filling and other operations were required. The steps were cumbersome and difficult.
Some vectors introduce "gateway technology" or use "homing endonuclease combined with Cre recombination technology". Although the above problems are partially solved, there are also problems such as high cost, special intermediate vectors, and special strains.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Multi-gene plant expression vector and construction method as well as application thereof
  • Multi-gene plant expression vector and construction method as well as application thereof
  • Multi-gene plant expression vector and construction method as well as application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1 Construction of cloning vector p6435x

[0041] 1. Synthesis of vector p1302x

[0042] Use 26# primer:

[0043] FAGATCTCCACTTCTAAAATGGCTACAGGCATCGTGGTGT (SEQ ID No. 1)

[0044] R GGTGACCCCACTTCTAAAATGGATTTTGCCTTCCTGTTTT (SEQ ID No. 2)

[0045] Using pUC18 as a template, PCR amplification was performed to obtain a fragment of about 500 bp, which was ligated into pUCm-T to synthesize vector p26; p26 and pCAMBIA1302 were double digested with BglII and BstEII, respectively. The small fragment of p26 and the large fragment of pCAMBIA1302 were recovered and ligated. Synthetic vector p1302x.

[0046] 2. Synthesis of vector p1302x30

[0047] Use 30# primer:

[0048] F aagcttagatctCTTGGATCAGATTGTCGT (SEQ ID No. 3)

[0049] R ggatccAGAGTCCCCCGTGTTCT (SEQ ID No. 4)

[0050] Using pCAMBIA1302 as a template, PCR amplification was performed to obtain a fragment of 597 bp, which was ligated into pUCm-T to synthesize vector p30. p30 and p1302x were double digested wit...

Embodiment 2

[0073] Example 2 Construction of transformation vector p209

[0074] 1. Synthesis of vector p88

[0075] Use 88# primer:

[0076] F gaattctctagaCTTCGGTTTCCGTGTT (SEQ ID No. 13)

[0077] RaagctTGATGCCTCCGTGTAA (SEQ ID No. 14)

[0078] PCR amplification was performed using pET28a as a template to obtain a fragment of about 300 bp in length. This fragment was ligated into pUCm-T to synthesize vector p88.

[0079] 2. Synthesis of plant transformation vector p209

[0080] p88 and pBI121 were double digested with HindIII and EcoRI, respectively. The small fragment of p88 and the large fragment of pBI121 were recovered and ligated to synthesize the plant transformation vector p209.

Embodiment 3

[0081] Embodiment 3 Construction of plant transformation vector carrying two insecticidal and toxic protein genes of BtCryIA and BtCryIIIA

[0082] 1. Construction of plant transformation vector p2096871

[0083] A general PCR reaction system was used, and the insecticidal toxin gene BtCryIA gene and BtCryIIIA gene were used as templates for PCR; PCR reaction procedures were as follows: pre-denaturation at 94°C for 10 min, denaturation at 94°C for 30s, annealing at 48-60°C for 40s, and extension at 72°C 1.5min, 20 cycles; 72°C extension for 20min. After the reaction, the presence or absence and length of the amplified product fragments were detected by 1% TAE agarose gel electrophoresis, and the gel was cut and the appropriate fragments were recovered using a gel recovery kit. The primers are shown in Table 1.

[0084] Table 1 Partial primers

[0085]

[0086]

[0087] Extract the p6435x plasmid, use the restriction endonuclease Eam1105I respectively, use a 50 μL enzym...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a multi-gene plant expression vector and a construction method as well as application thereof. The multi-gene plant expression vector comprises a plant transformation vector p209, a cloning vector p6435x and one or more target genes to be transformed. According to construction of the multi-gene plant expression vector, by utilizing the characteristic that the original enzyme cutting site disappears after isocaudarners are connected, and the two ends of a vector or a segment after enzyme cutting are different viscous segments all the time; and thus, the problem of limited endonuclease sites of the conventional vector is solved, meanwhile, self-connection in a vector connection process is also avoided, phosphorylation treatment at the viscous tail end is not required, an intermediate vector and a special engineering strain are not required yet, most of restriction endonuclease sites are avoided, the conventional steps of enzyme cutting, connection, transformation and the like are not required, the operation steps are simplified, the experimental difficulty is reduced, and the technology is mature and reliable, and low in cost, can be finished under normal experimental conditions and is convenient to promote.

Description

technical field [0001] The invention relates to a plant expression vector, in particular to a plant expression vector carrying single or multiple exogenous genes and a construction method thereof. The invention also relates to the application of the plant expression vector in transgenic plants, which belongs to the category of plant expression vector. Build the field. Background technique [0002] At present, plant transgenic research mainly focuses on the transformation of a single gene, which has a single function and limited effect. Co-transformation of multiple genes has become a way to solve this problem. [0003] The construction of multi-gene plant transformation vector is the basic and important step to realize multi-gene simultaneous transformation of plants. Almost all plant transgenic research starts from the construction of vector. In the past, the construction of multi-gene expression vectors was limited by restriction enzyme sites, and the number of genes car...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82C12N15/66C12N5/10A01H5/00
Inventor 董研杨敏生
Owner HEBEI AGRICULTURAL UNIV.