Nucleotide sequence and vector for directional cloning

A nucleotide sequence and carrier technology, applied in the field of molecular biology, can solve problems such as low technical requirements, high cost, and high enzyme cutting conditions, and achieve the effects of ensuring positive rate, preventing self-ligation, and reducing costs

Active Publication Date: 2013-02-27
BGI SHENZHEN CO LTD
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the disadvantage of the double enzyme digestion method is that the cost is high, and two enzymes need to be used at the same time; When multiple foreign fragments are inserted into the multiple cloning site, a suitable enzyme cutting site may not be found; in addition, if the optimum reaction temperature or reaction buffer (Buffer) of the two enzymes are different, or the two enzymes cannot be When reacting in the same Buffer, it will involve the choice of reaction temperature and Buffer and even step-by-step enzyme digestion, which increases the complexity of the operation
[0003] For the method of constructing a recombinant vector by single enzyme digestion, only one restriction endonuclease is used for digestion and ligation, which costs less and requires less technology, and when multiple fragments are inserted into the multi-cloning site, it is relatively In terms of double enzyme digestion, there are more enzyme cutting sites to choose from; however, the disadvantage of this method is that directional cloning is not possible. After enzyme digestion and ligation, sequencing is required to determine whether there is an insert fragment and whether the direction of the insert fragment is correct, so as to construct a correct recombinant vector. The probability is less than 50%. Therefore, the sample size for sequencing is at least twice that of the double-enzyme digestion method, and the cost of sequencing is higher than that of the double-enzyme digestion method.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleotide sequence and vector for directional cloning
  • Nucleotide sequence and vector for directional cloning
  • Nucleotide sequence and vector for directional cloning

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Example 1 P11 vector construction

[0048] 1. PCR amplification of maize Ubiquitin promoter fragment and construction of pMD18-T+Ubi recombinant vector

[0049] Ubi promoter PCR amplification

[0050] Genomic DNA of maize variety B73 (Zea mays mays cv. http: / / www.maizegdb.org / ), according to the sequence of Ubi promoter in maize B73 gDNA, a pair of PCR-specific amplification primers were designed at the beginning and end respectively (upstream primer F1: GG CTGCAG TGCAGCGTGACCCGGTCGT (SEQ ID NO: 1), plus restriction site PstI and protection base, downstream primer R1: GG CTGCAG AAGTAACACCAAAC (SEQ ID NO: 2), plus restriction site Pst I and protection bases). Using the gDNA of corn B73 extracted above as a template, high-fidelity Ex Taq TM (TaKaRa, DRR100B) polymerase for PCR amplification. As shown in Table 1.

[0051] Table 1 PCR system for gene promoter amplification

[0052] Composition Volume (μl)

[0053] Genomic DNA 0.2

[0054] dNTPs (2.5mM) 2

[...

Embodiment 2

[0144] The PCR amplification of the target gene CaMV35S promoter sequence fragment of embodiment 2 (Primestar amplification Increase) and the construction of the recombinant vector DJET+A

[0145] 1. PCR amplification

[0146] According to the CaMV35S promoter sequence in the pCAMBIA-1301 plasmid, a pair of gene-specific primers (upstream primer 35S-F, plus restriction enzyme site BstE Ⅱ (GGT TACC) and protective base were designed at the beginning and end respectively, and downstream primer 35S- R, plus restriction enzyme cutting site BstE Ⅱ (GGT GACC) and protective bases), using pCAMBIA-1301 plasmid as a template, high-fidelity Taq polymerase for PCR amplification.

[0147] 35S-F: A GGTTACC GCTTCATGGAGTCAAAGATTC (SEQ ID NO: 9)

[0148] 35S-R: A GGTGACC TCTACCATGGTCAAGAGTCC (SEQ ID NO: 10)

[0149] Gene amplification PCR system: 25μl

[0150] wxya 2 O 10.3 μl

[0151] 2×Primer Star Mix 12.5μl

[0152] pCAMBIA-1301 plasmid 0.2μl

[0153] Primer 35S-F 1μl

[01...

Embodiment 3

[0168] The PCR amplification (Primestar amplification) of the target gene hygromycin resistance gene sequence fragment of embodiment 3 Increase) and construction of recombinant vector pJET+B

[0169] 1. PCR amplification

[0170] According to the hygromycin resistance gene sequence (Hyg) in the pCAMBIA-1301 plasmid, a pair of gene-specific primers (upstream primer Hyg-F, plus restriction enzyme site BstEII (GGT TACC) and protective bases were designed at the beginning and end respectively , downstream primer Hyg-R, plus restriction site BstEII (GGT GACC) and protective bases), pCAMBIA-1301 plasmid as a template, high-fidelity Taq polymerase for PCR amplification.

[0171] Hyg-F: A TCAGTTAGCCTCCCCCATCTCC (SEQ ID NO: 12)

[0172] Hyg-R: A ATATGAAAAAGCCTGAACTCA (SEQ ID NO: 13)

[0173] PCR system: 25μl

[0174] wxya 2 O 11.3 μl

[0175] 2*Primer Star Mix 12.5μl

[0176] pCAMBIA-1301 plasmid 0.2μl

[0177] Primer Hyg-F 0.5μl

[0178] Primer Hyg-R 0.5μl

[0179] PC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of molecular biology, and particularly relates to a nucleotide sequence for directional cloning and a vector constructed by using the sequence and capable of realizing directional cloning by single enzyme digestion. The vector is in operable connection with a corn ubiquitin promoter sequence and an NOS (nitric oxide synthase) terminator sequence. The invention also relates to application of the nucleotide sequence for the directional cloning in constructing the vector, and application of the vector in plant gene expression, in particular monocotyledon or dicotyledon gene expression. Compared with a dual enzyme digestion vector, the single enzyme digestion vector of the invention reduces the cost, and saves the time.

Description

technical field [0001] The invention belongs to the field of molecular biology, and in particular relates to a nucleotide sequence for directional cloning and a plant gene expression vector constructed by using the sequence. Background technique [0002] At present, when constructing plasmids or viral vectors through genetic recombination, the method of double digestion is generally used, that is, two restriction endonucleases with different restriction sites are used to simultaneously digest the vector to insert the exogenous target fragment. This method has the advantage of directional cloning, which can ensure the direction of inserting foreign fragments. After the vector and inserting fragments are double-enzymatically digested and ligated, there is no need to identify the directionality of the inserting fragments; and it can prevent the self-ligation of the vector and increase the recombination rate. However, the disadvantage of the double enzyme digestion method is tha...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/11C12N15/63C12N15/82C12N5/10
Inventor张耕耘全志武倪雪梅李华
OwnerBGI SHENZHEN CO LTD