PCR detection kit for zaocys dhumnades

A technology of black snake and kit, applied in the field of identification of traditional Chinese medicine and Chinese medicinal materials

Inactive Publication Date: 2012-12-19
INST OF CHINESE MATERIA MEDICA CHINA ACAD OF CHINESE MEDICAL SCI
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Before the present invention is published, there is not yet any PCR kit and corresponding PCR contrast substance that are specially used in the identification of black snake

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • PCR detection kit for zaocys dhumnades
  • PCR detection kit for zaocys dhumnades
  • PCR detection kit for zaocys dhumnades

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Embodiment 1: the configuration of black-headed snake PCR detection kit

[0022] This embodiment provides 10 detection times and storage conditions of various components, and the specific quantity configured in the kit can be adjusted according to needs during specific implementation.

[0023]

[0024] Note: The working concentration of 50×TAE buffer is 1×TAE buffer; all reagents should be stored according to the specified conditions; 2×Taq PCR Green Mix is ​​recommended to be aliquoted in small quantities to avoid repeated freezing and thawing.

Embodiment 2

[0025] Embodiment 2: the detection method of black snake kit

[0026] The detection method of the above kit comprises the following steps:

[0027] 2.1 DNA extraction

[0028] 2.1.1 Preparation before experiment

[0029] Prepare a clean mortar, pestle and spoon

[0030] Add all the RNase solution (for removing RNA) to the nucleus lysate Ⅰ and store at 4°C

[0031] Add 24ml of 95% absolute ethanol to the eluent, mark the bottle and store it at room temperature

[0032] 2.1.2 Template DNA extraction

[0033] ①Take an appropriate amount (about 0.5g) of the test sample, remove surface pollutants, grind it fully in liquid nitrogen to make powder, and take an appropriate amount (0.1ml scale) into a 1.5ml centrifuge tube;

[0034] ② Add 255 μl of cell nucleus lysate I (for lysing cell walls, etc.), and mix well;

[0035] ③ Add 20 μl proteinase K and mix well;

[0036] ④ Place it in a 55°C water bath and incubate for 1 hour;

[0037] ⑤ After taking it out, add 250 μL lys...

Embodiment 3

[0063] Embodiment 3: the preparation of PCR control substance

[0064] 3.1 PCR amplification with universal primers

[0065] Using the universal primer WS_ty_F: GGCCAGCAGCAGTAGTTAATATTAG; WS_ty_R:

[0066] TGGCGACGGCGGTATATAGACT amplified the total DNA of genuine black snake snake and counterfeit chinchilla snake respectively. Primers were synthesized by Huada Gene Technology Co., Ltd.

[0067] Perform PCR reactions in 200 µL centrifuge tubes. The total reaction volume was 25 μL, including 2.5 μL of 10×PCR buffer, dNTP (2.5 mmol L -1 ) 2 μL, universal primer (10 μmol L -1 ) each 0.5μL, Ex Taq DNA polymerase (5U·L -1 ) 0.2 μL, template 0.5 μL, make up the reaction volume with sterile double distilled water. Put the centrifuge tube into the PCR machine, and the PCR reaction parameters: pre-denaturation at 94°C for 5 minutes, cycle reaction 35 times (94°C for 30s, 56°C for 30s, 72°C for 30s), extension at 72°C for 5 minutes, and incubation at 4°C to end the reaction. Take ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a kit for detecting zaocys dhumnades by using a PCR technology. The kit is composed of three systems of DNA extraction, PCR amplification and agarose gel detection, wherein positive control of PCR in the kit is pGEM-WS plasmids with an insertion sequence of SEQ ID.5; and the negative of PCR in the kit is pGEM-HS plasmids with an insertion sequence of SEQ ID.5. With the kit, determination for sample authenticity can be completed by simple DNA extraction, PCR amplification and electrophoresis detection without preparing any reagents. The kit has the advantages of simple operation, strong specificity, good repeatability and the like, and can be used for quick determination of zaocys dhumnade medical materials, preparations containing zaocys dhumnades and zaocys dhumnade living materials.

Description

technical field [0001] The invention relates to the technical field of identification of traditional Chinese medicines and Chinese medicinal materials, in particular to a PCR detection kit capable of rapidly identifying black snakes. It is mainly used for rapid identification of black snake medicinal materials, preparations containing black snake and living materials of black snake. Background technique [0002] Wushao snake is a commonly used traditional Chinese medicine recorded in "Chinese Pharmacopoeia" (2005 edition), which is derived from the dried body of Zaocys dhumnades Cantor, an animal of the family Viridae. It has the effects of expelling wind, dredging collaterals, and relieving spasm. It is used for rheumatism intractable numbness, numbness and spasm, hemiplegia, convulsions and spasms, and scrofula. [0003] In view of the definite clinical efficacy of black snake as a traditional Chinese medicine, but the current situation of complex commodity sources and di...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
Inventor 黄璐琦崔光红赵静雪李昶唐晓晶
Owner INST OF CHINESE MATERIA MEDICA CHINA ACAD OF CHINESE MEDICAL SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap