Recombinant expression plasmid vector stable in Hafnia alvei, and application thereof

A technology of Hafnia hives and recombinant plasmids, applied in the field of molecular biology, can solve problems such as health and ecological environment hazards, and antibiotics are not environmentally friendly

Active Publication Date: 2013-01-02
CATHAY R&D CENT CO LTD +1
View PDF4 Cites 30 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The use of antibiotics is not environmentally friendly due to the health and ecological hazards of antibiotic-resistant bacteria

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant expression plasmid vector stable in Hafnia alvei, and application thereof
  • Recombinant expression plasmid vector stable in Hafnia alvei, and application thereof
  • Recombinant expression plasmid vector stable in Hafnia alvei, and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0086] The construction of embodiment 1-CadA recombinant expression plasmid

[0087] Using Escherichia coli BL21 (Biomed Company) chromosomal DNA as a template, use primers 1 and 2 (primer 1, SEQ ID: NO 7: ATGAACGTTATTGCAATATT, primer 2, SEQ ID: NO 8: ACTGAAAGCTTCCACTTCCCTTGTACGAGCT) to replicate the cadA gene ( figure 1 a). This PCR product was ligated to pUC18-derived T vector, pMD18-T (TaKaRa). The ligation product of the cadA gene and the lac promoter (Plac) in the same direction was selected. The resulting plasmid was named pMD18-T-cadA ( figure 1 b).

[0088] The cadA gene contained in pMD18-T-cadA is in the same reading frame as a small section of lacZ gene at the 5' end. Therefore, this redundant lacZ fragment was deleted by site-directed mutagenesis PCR. The PCR reaction included: 50ng plasmid DNA, 10pmole primer 3 (SEQ ID: NO 9: ATTCAATATTGCAATAACGTTCATAGCTGTTTCCTGTGTG), dNTPs (0.25mM each), 1 μL Pfu DNA polymerase (Biomed), 1 μL Taq DNA ligase (NEB), 4 μL Pfu...

Embodiment 2

[0091] Example 2 - Elimination of endogenous plasmids from Hafnia alvei

[0092] Plasmid elimination was performed on a strain of H. alvei (Ha) carrying the pAlvB endogenous plasmid. First, a pUC-derived plasmid expressing antitoxin was used to release the host's dependence on pAlvB for survival. The pUC-derived plasmid was used as the backbone plasmid because it can replicate in H. alvei and its copy number can increase with increasing culture temperature. Therefore, under the condition of antibiotic selection and higher culture temperature, pUC plasmid has an advantage in competition with pAlvB, making the latter easy to lose. The Abi antitoxin protein recombinantly expressed on the pUC plasmid can neutralize the Abt toxin protein left by pAlvB, so that the host cells will not die.

[0093] Using pAlvB as a template, the abi gene was replicated with primers 6 and 7 (primer 7, SEQ ID: NO 13: ACTGAAAGCTTTTTAATTGTGTGACCACTAT). The PCR product was ligated into the pMD18-T vec...

Embodiment 3

[0097] Example 3 - Toxin / antitoxin gene pair stabilizes the CadA expression plasmid in H.alvei

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a stable recombinant expression plasmid vector comprising a fragment of polynucleotide encoding a recombinant antitoxin gene. The polynucleotide expresses a polypeptide used for neutralizing toxic polypeptide of a host cell. The toxic polypeptide is expressed in a host cell by a fragment of polynucleotide encoding a toxin gene. The recombinant expression plasmid vector also comprises a fragment of polynucleotide encoding polypeptide expression product. The stable recombinant expression plasmid vector is derived by replicable frame plasmid in Hafnia alvei. The invention also discloses a transformant of the stable recombinant expression plasmid, a method for preparing bio-based pentanediamine by using the transformant, and bio-based pentanediamine prepared with the method provided by the invention. The invention also discloses polyamide and a composition containing polyamide, which are prepared by using the bio-based pentanediamine prepared with the method as a raw material. The invention also discloses a method for preparing pentamethylene-1,5-diisocyanate. The method comprises the steps that: bio-based pentanediamine is prepared by using the method provided by the invention; and the bio-based pentanediamine is transformed into pentamethylene-1,5-diisocyanate.

Description

technical field [0001] The application belongs to the field of molecular biology, and specifically relates to a stable recombinant expression plasmid vector and its application. Background technique [0002] Pentylenediamine is a platform compound that can be used in the production of a variety of chemicals. Since the 1980s, the research field of biological production of pentamethylenediamine has gained widespread attention. In biological methods, pentamethylenediamine can be produced by decarboxylation of lysine. At present, the following two methods are mainly used for the biological production of pentamethylenediamine: microbial fermentation production or in vitro enzyme-catalyzed production. [0003] In the method for producing lysine by fermentation, the lysine decarboxylase gene is added to lysine producing strains (such as Corynebacterium glutamicum and E. Diamine pathway. However, reported yields of pentamethylenediamine were lower than those for lysine using the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/63C12N1/21C12P13/00C08G69/26C08L77/06C12R1/01
Inventor庞振华李乃强刘驰
OwnerCATHAY R&D CENT CO LTD