Check patentability & draft patents in minutes with Patsnap Eureka AI!

Method for simulating recombination and non-trace cloning

A cloning method and template technology, applied in the direction of recombinant DNA technology, the use of vectors to introduce foreign genetic material, etc., can solve the problems of high mutation rate, non-specific recombination of target genes, low amplification efficiency, etc., and achieve the effect of reducing mutations

Inactive Publication Date: 2013-05-01
HANGZHOU NORMAL UNIVERSITY
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There are also some problems with this method: when the restriction site on the vector conflicts with the target gene fragment, it is often necessary to modify the vector; when the target gene has a high GC content or a stable secondary structure, it is often difficult for us to obtain sufficient A large amount of PCR amplification products; in addition, when the target gene fragment is very long, it is easy to cause the problems of low amplification efficiency and high mutation rate
Fu J. et al. (2012) invented a method for recombining large fragments of DNA in Escherichia coli using full-length RecE, RecT, Redγ and RecA recombinases (Fu J, Bian X, Hu S, Wang H, Huang F, Seibert PM, Plaza A, Xia L, Müller R, Stewart AF, Zhang Y. Full-length RecE enhances linear-linear homologous recombination and facilitates direct cloning for bioprospecting. Nat Biotechnol. 2012 May;30(5 ):440-6.), however, this method relies on recombinases and has the risk of non-specific recombination within the target gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for simulating recombination and non-trace cloning
  • Method for simulating recombination and non-trace cloning
  • Method for simulating recombination and non-trace cloning

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] 1.1. Detect the efficiency of simulated recombinant traceless clones.

[0035] First, a segment ( figure 2 ) to test efficiency.

[0036] 1.1.1. Preparation of target DNA fragments.

[0037] In 40μl 1×NEB Buffer (New England Biolabs), 2μg Lambda DNA (Sangon) was incubated with 20U AluI endonuclease (New England Biolabs) at 37°C React for 4 hours to completely digest the Lambda DNA. Then heat to 70° C. and incubate for 10 minutes to inactivate the endonuclease, and the product obtained is a Lambda DNA digestion product with a final concentration of 50 ng / μl.

[0038] Table 1: Primers used to detect the efficiency of mock recombination scarless cloning

[0039] Overlap Primers Sequences (5'-3') 0 bp 0bpP1 ATCGAATTCCTGCAGCC 0bpP2 ATCAAGCTTATCGATACCG 15bp 15bpP1 TGCCGTCGTTGTTAA ATCGAATTCCTGCAGCC 15bpP2 AGAGTGATTTGCCGT ATCAAGCTTATCGATACCG 20bp 20bpP1 GTTCGTGCCGTCGTTGTTAA ATCGAATTCCTGCAGCC 20bpP...

Embodiment 2

[0068] 2.1. Clone the Sox10 ORF into pGEX-4T-1 by using the analog recombination traceless cloning method

[0069] The coding region (ORF) of the Sox10 gene has 1401bp, and the GC content reaches 63.24%. It failed to add a restriction site and its protective base at the 5' end of the conventional primer, and used the high-fidelity Phusion DNA polymerase (New England Biolabs) to amplify the target gene fragment by PCR, and then ligate it into the pGEX-4T-1 vector after enzyme digestion. Therefore, the Sox10 ORF was subcloned from the pBlueScript II KS(-) vector into the pGEX-4T-1 vector using the simulated recombination scarless cloning method to obtain the GST-Sox10 fusion expression plasmid.

[0070] 2.1.1. Preparation of target DNA fragments.

[0071] In 20 μl NEB buffer 4+BSA (New England Biolabs) reaction system, add 1 μg pBlueScript II KS(-) plasmid containing Sox10 ORF and use 10 U of endonucleases EcoRI-HF and XhoI (New England Biolabs) at 37°C React for 4 hours, th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for simulating recombination and non-trace cloning, which is characterized in that when a carrier primer is designed, a fragment of DNA basic group having a same sequence with a target gene is respectively added at 5' terminal of the primer, the obtained carrier DNA terminal and the inner part of the target gene have a coupling area, the carrier DNA and the target gene are mixed, and Lambda Exonuclease and T4 DNA polymerase are used for treatment to obtain recombinant DNA. The method for simulating recombination and non-trace cloning has the following beneficial effects that 1) the target gene amplified through PCR is not required, the mutation caused by PCR is reduced; 2) the target fragment can be specifically cloned in a DNA mixture; and a trace of an enzyme site is not kept.

Description

(1) Technical field [0001] The invention relates to a method for simulating recombinant scarless cloning. (2) Background technology [0002] It has become a classic cloning method to amplify the target gene fragment by PCR by adding a restriction site and its protective base at the 5' end of the primer, and then ligate it into a specific vector after digestion. There are also some problems with this method: when the restriction site on the vector conflicts with the target gene fragment, it is often necessary to modify the vector; when the target gene has a high GC content or a stable secondary structure, it is often difficult for us to obtain sufficient A large amount of PCR amplification products; in addition, when the target gene fragment is very long, it is easy to cause problems of low amplification efficiency and high mutation rate. Fu J. et al. (2012) invented a method for recombining large fragments of DNA in Escherichia coli using full-length RecE, RecT, Redγ and Re...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/70C12N15/66
Inventor 戴忠敏齐瀛川孙淑慧邱猛生
Owner HANGZHOU NORMAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More