Application of RNA and carrier in preparation of product for preventing and/or treating liver cancer

A carrier and product technology, applied in the application field of RNA and carrier in the preparation of prevention and/or treatment of liver cancer products, can solve the problem of no drug treatment, etc., and achieve the effect of low human pathogenicity and wide host range

Active Publication Date: 2013-05-08
INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
View PDF3 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In China, HCC is mostly caused by chronic hepatitis B infection, and there is currently no effective drug treatment in clinical practice

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of RNA and carrier in preparation of product for preventing and/or treating liver cancer
  • Application of RNA and carrier in preparation of product for preventing and/or treating liver cancer
  • Application of RNA and carrier in preparation of product for preventing and/or treating liver cancer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Example 1, construction of miR-122, recombinant adenovirus vector containing miR-122 encoding gene and adenovirus expressing miR-122

[0057] 1. Acquisition of miR-122

[0058] Synthetic miR-122 was synthesized in Guangzhou Ruibo Biotechnology Co., Ltd.

[0059] The nucleotide sequence of miR-122 is sequence 1 in the sequence listing.

[0060] The negative control RNA of miR-122 was purchased from Guangzhou Ruibo Biotechnology Co., Ltd. (for miRNA mimic Ncontrol#22 product information:

[0061] Basic information: common miRNA mimic Ncontrol#22 for humans, mice, and rats

[0062] Mature miRNA name: cel-miR-239b-5p

[0063] Mature miRNA number: MIMAT0000295

[0064] Mature miRNA sequence: UUUGUACUACACAAAAGUACUG)

[0065] 2. Construction of adenovirus recombinant vector containing miR-122

[0066] The nucleotide sequence of the gene encoding the miR-122 precursor is sequence 3 in the sequence table, the gene encodes the miR-122 precursor, and miR-122 (sequence 1) is ...

Embodiment 2

[0117] Example 2, application of miR-122, recombinant adenovirus vector containing miR-122 encoding gene and adenovirus expressing miR-122

[0118] 1. Application of miR-122 and adenovirus expressing miR-122 in the treatment of HBV transgenic mice

[0119] A. The application of miR-122 in the treatment of HBV transgenic mice

[0120] HBV transgenic BALB / c mice aged 6-8 weeks (purchased from the Liver Disease Center of the 458th Hospital of the Chinese People's Liberation Army); mice with similar body weight, about 16g, were randomly divided into 2 groups, 5 mice in each group .

[0121] miR-122 solution: every 10nM miR-122 was dissolved in 0.1ml of PBS (8g / L NaCl, 0.2g / L KCl, 3.628g / LNa 2 HPO 4 12H 2 0.0.24g / L KH 2 PO 4 and water, pH 7.4), to obtain miR-122 solution;

[0122] Negative control RNA solution of miR-122: every 10nM of miR-122 negative control RNA was dissolved in 0.1ml of PBS (8g / LNaCl, 0.2g / L KCl, 3.628g / L NaCl 2 HPO 4 12H 2 0.0.24g / L KH 2 PO 4 and wa...

Embodiment 3

[0222] Example 3, miR-122, the vector containing the gene encoding miR-122 or the application of the adenoviral vector containing the gene encoding miR-122 in inhibiting HBV replication ability in vitro

[0223] 1. Application of miR-122 in inhibiting HBV replication ability

[0224] HepG2 cells were inoculated into 6-well plates one day before transfection, and the confluence of cells reached about 70% during transfection, and the medium was replaced with opti-MEM (life technologies catalog number: 31985070) one hour in advance.

[0225] miR-122 group: HepG2 cells were co-transfected with miR-122 and plasmid pHBV1.3 using lipo2000 to obtain HepG2 cells / miR-122; the optimal transfection ratio of RNA and pHBV1.3 replicating plasmid was 2.5 in volume and mass ul: 1ug, 4-6 hours the cells were washed three times with PBS, and replaced with 2ml of 10% FBS DMEM full medium.

[0226] Negative control group: the same method was used to co-transfect HepG2 cells with miR-122 negative ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Titeraaaaaaaaaa
Login to View More

Abstract

The invention discloses application of RNA and carrier in preparation of a product for preventing and / or treating liver cancer. The invention provides a recombinant adenovirus carrier which is a recombinant adenovirus carrier formed by inserting at least one encoding gene of miR-122 into a pDC312-cmv; and the miR-122 refers to RNA shown in a sequence 1 in a sequence table or RNA encoded by a sequence 3 in the sequence table. The experiment proves that the miR-122 encoding genes are introduced into the adenovirus carrier, the adenovirus is purified and is used for performing an animal experiment, the miR-122 and the recombinant adenovirus carrier or adenovirus can obviously suppress the liver cancer caused by chronic hepatitis B infection, and a novel liver cancer treatment medicine can be developed.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the application of an RNA and a carrier in the preparation of a product for preventing and / or treating liver cancer. Background technique [0002] At present, 350 million people in the world are infected with HBV (hepatitis B virus), and about 93 million people in China are chronically infected with HBV. About 15-40% of the infected people may develop life-threatening diseases such as liver cirrhosis and liver failure and hepatocellular carcinoma, chronic HBV infection seriously endangers people's health. Existing treatments for patients with chronic hepatitis B include alpha-interferon (IFN-α) and nucleosides or nucleoside analogs (such as lamivudine, adefovir, and entecavir), interferon-α being the first Obtain clinical drugs for the treatment of hepatitis B virus infection. As an important first-line drug, pegylated interferon-α monotherapy can effectively treat 25-40% of chronic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/861C12N7/01A61K48/00A61P35/00A61P1/16A61P31/20
Inventor孟颂东郝军莉李长菲胡俊
OwnerINST OF MICROBIOLOGY - CHINESE ACAD OF SCI