Application of N-acetylglucosamine isomerase in production of N-acetylmannosamine

A technology of acetylglucosamine and acetylmannosamine, which is applied in the field of invention, can solve problems such as undiscovered PmAGE, and achieve the effect of reducing production cost

Active Publication Date: 2013-05-08
NANJING UNIV OF TECH
View PDF7 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, no report of PmAGE being used for ManNAc synthesis has been found

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of N-acetylglucosamine isomerase in production of N-acetylmannosamine
  • Application of N-acetylglucosamine isomerase in production of N-acetylmannosamine
  • Application of N-acetylglucosamine isomerase in production of N-acetylmannosamine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1: Construction of recombinant Escherichia coli E. coli Rosseta (pET28a-PmAGE).

[0034] 1. Acquisition of N-acetylglucosamine isomerase gene:

[0035] Cells of marine-derived cyanobacteria Prochlorococcus marinus str. MIT9215 (from Prof. Chisholm, Massachusetts Institute of Technology) were frozen in liquid nitrogen for 1 minute and then transferred to 100°C boiling water for 10 minutes. The seaweed thus treated was used as a template for PCR.

[0036] The primers used to construct the expression vectors are provided with enzyme cutting sites, and the primer sequences are as follows:

[0037] The upstream primer (PmAGE-sense containing EcoR I) is:

[0038] 5'CCG GAATTC ATGCAAAAATATATAAACGAATATCTAAG

[0039] Downstream primers (PmAGE-anti with Not I) are:

[0040] ATTT GCGGCCGC TTATTTAAACAATGTTGTATTTTTT

[0041] All primers were synthesized by Nanjing GenScript Company.

[0042] Gene PCR conditions:

[0043] Denaturation at 94°C for 5 min, cycled 30 t...

Embodiment 2

[0046] Example 2: Study on the acquisition and properties of the isomerase PmAGE.

[0047] 1. Expression of N-acetylglucosamine isomerase PmAGE.

[0048] Pick the recombinant strain E.coli Rosseta (pET-28a-PmAGE) into the LB liquid medium containing antibiotics, and cultivate it overnight at 37°C with shaking. Then they were inoculated into fresh culture medium according to 2% inoculation amount, and cultivated to OD at 37°C. 600 At about 0.6, add IPTG to a final concentration of 0.5mmol·L -1 , 15°C, 220rpm, after induction of expression for 12h, centrifuge (4°C, 10000rpm, 10min).

[0049] 2. Purification of N-acetylglucosamine isomerase PmAGE.

[0050] The collected sludge was resuspended with phosphate buffer (50mM, pH7.5) containing 300mM NaCl and 30% glycerol, and the cells were disrupted by ultrasonic (power 300W, ultrasonic 5s, intermittent 5s, total 5min), centrifuged (4°C, 12000rpm, 15min) to take the supernatant.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of N-acetylglucosamine isomerase of which the amino acid sequence is shown as SEQ ID NO:2 in catalytic synthesis of N-acetylmannosamine. The N-acetylmannosamine is prepared by taking the N-acetylglucosamine isomerase of which the amino acid sequence is shown as SEQ ID NO:2 as a catalyst and taking N-acetylglucosamine as a substrate. According to the invention, the N-acetylglucosamine isomerase of which the amino acid sequence is shown as SEQ ID NO:2 is used in the preparation of the N-acetylmannosamine for the first time, and favorable effect is achieved.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to an application of N-acetylglucosamine isomerase (N-acetylglucosamine 2-epimerase, AGE), in particular to a kind of N-acetylglucosamine isomerase from seaweed Prochlorococcus marinus str.MIT9215. Application of PmAGE in the production of N-acetyl-D-mannosamine (ManNAc) with N-acetyl-D-glucosamine (GlcNAc) as substrate. Background technique [0002] N-acetyl-mannosamine (N-acetyl-D-mannosamine, ManNAc) is an important intermediate, which can be used as anti-influenza drug precursor and infant milk powder additive N-acetylneuraminic acid (N-acetyl-D- neuraminic acid, Neu5Ac) synthesis. [0003] Using N-acetyl-D-glucosamine (GlcNAc) as a substrate for the synthesis of ManNAc, and then using ManNAc and pyruvate as substrates through N-acetylneuraminic acid lyase (N-acetylneuraminic acid lyase, Nal) catalyzed synthesis of N-acetylneuraminic acid is currently the most important way to synth...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12P19/26C12P19/24C12P19/02C12R1/19
Inventor应汉杰季雯燕谢婧婧孙梧进陈勇陈晓春吴菁岚
OwnerNANJING UNIV OF TECH