Unlock instant, AI-driven research and patent intelligence for your innovation.

MicroRNA (ribonucleic acid) detection probe and method for detecting microRNA

A technology for detecting probes and probes, which is applied in the fields of molecular biology and nucleic acid chemistry, can solve problems such as large limitations, high price, and limited sensitivity, and achieve the effects of simplified design, strong specificity, and low detection limit

Inactive Publication Date: 2013-06-19
WUHAN UNIV
View PDF1 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] MicroRNA has attracted extensive research interest due to its importance, and the development of detection methods for them has received great attention from scientists, but so far, there is no very good detection method
The sensitivity of the traditional northern hybridization method is very limited, and although the detection method based on the chip has the advantage of high throughput, it is very expensive and depends on the supporting use of large and expensive instruments, which has great limitations

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • MicroRNA (ribonucleic acid) detection probe and method for detecting microRNA
  • MicroRNA (ribonucleic acid) detection probe and method for detecting microRNA
  • MicroRNA (ribonucleic acid) detection probe and method for detecting microRNA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] 1. Design of microRNAs detection probe system

[0036] (1) if figure 1 As shown, the probe was synthesized from Dalian Bao Biology Co., Ltd., and the probe was aimed at the sequence of miR141, the sequence of which is: UAACACUGUCUGGUAAAGAUGG (SEQ ID No 1). miR141 is an important tumor marker. The probe consists of three parts, the region complementary to the target microRNA, which is responsible for recognizing the corresponding microRNA and forming a DNA-RNA hybrid duplex structure. One end is labeled with biotin, and the probes that do not participate in the reaction are bound to the solid phase by using the streptavidin-biotin system, and the unreacted probes are separated. The other end is connected with DNase as a signal output part. The probe sequence is: biotin-TTTTTTTTTTTT CCATCTTTACCAGACAGTGTTA TGGGTAGGGCGGGTTGGG (SEQ ID No 2).

[0037] (2) The detection goal to be achieved: the corresponding target microRNA probe can produce a good signal response, the fluo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a microRNA (ribonucleic acid) detection probe and a method for detecting microRNA. The detection probe comprises three parts, an intermediate region is of single-stranded DNA (deoxyribonucleic acid) which is complementary to the microRNA, one end of the single-stranded DNA is connected with a DNA enzyme as a signal output part, and labeled biotin is arranged at the other end of the single-stranded DNA. The probe is added in a system to be detected, the single-stranded DNA of the probe and the target microRNA are complementary and paired, DSN (duplex-specific nuclease) selectively digests a DNA-RNA hybrid DNA chain, and the RNA can be recycled. Streptavidin magnetic beads are added, and the magnetic beads and the probe labeled by the non-reacted biotin are removed from a water solution through a ferromagnetic body. The part of the solution is still used for further signal output reaction. The detection method disclosed by the invention adopts DSN amplification and ribozyme amplification, and becomes a method for detecting the microRNA, which has the advantages of low background, high sensitivity and strong specificity.

Description

[0001] technical field [0002] The invention belongs to the fields of molecular biology and nucleic acid chemistry, and relates to a microRNA detection probe and a method for detecting microRNA. Background technique [0003] MicroRNA (microRNAs; miRNA, also translated as small molecule RNA) is a kind of RNA molecule about 21 to 23 nucleotides widely present in eukaryotes, which can regulate the expression of other genes. miRNAs originate from some RNAs (non-coding RNAs) that are transcribed from DNA but cannot be further translated into proteins. miRNA inhibits post-transcriptional gene expression by specifically binding to target messenger ribonucleic acid (mRNA), and plays an important role in regulating gene expression, cell cycle, and the timing of organism development. In animals, a single microRNA can often regulate dozens of genes. [0004] These RNAs transition from primary transcripts, or pri-miRNAs, to stem-loop structures called pre-miRNAs, and finally to funct...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
Inventor 周翔彭双王少儒田沺翁小成
Owner WUHAN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More