Unlock instant, AI-driven research and patent intelligence for your innovation.

Aspergillus bacterial strain and endo-chitosan enzyme CsnW2 encoding gene, preparation method and application thereof

A technology of Aspergillus and glycanase, which is applied in application, genetic engineering, plant genetic improvement and other directions, can solve the problems of poor homology of chitosanase, no reports on cloning and expression, and few studies, and achieve large-scale production. Effects of potential and economic value

Active Publication Date: 2013-07-24
DALIAN INST OF CHEM PHYSICS CHINESE ACAD OF SCI
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The two families of chitosanases have poor homology, and currently there are many studies on chitosanases derived from bacteria, but less studies on chitosanases derived from fungi, especially Aspergillus clavus.
Cloning and expression of chitosanase gene derived from Aspergillus clavus has not been reported so far

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Aspergillus bacterial strain and endo-chitosan enzyme CsnW2 encoding gene, preparation method and application thereof
  • Aspergillus bacterial strain and endo-chitosan enzyme CsnW2 encoding gene, preparation method and application thereof
  • Aspergillus bacterial strain and endo-chitosan enzyme CsnW2 encoding gene, preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0081] The cultivation of embodiment 1 Aspergillus clavatus W-2 and the production of chitosanase

[0082] The strain used was Aspergillus clavatus, and a single clone of the Aspergillus clavatus W-2 strain (CGMCC NO.7018) was picked and inoculated into 30ml liquid medium, and then cultured on a shaker with a temperature of 30°C and a rotation speed of 150rpmin After 4 days, the culture solution was centrifuged to collect the supernatant medium.

[0083] The liquid medium formula used is (g / L): chitosan 5.0g, yeast extract powder 0.5g, NaCl0.5g, MgSO4 7H2O1.44g, CaCl20.1g, KCl0.5g, K2HPO42.0g, KH2PO41.0g , the pH value is 7.0, and the balance is water.

[0084] Definition of enzyme activity unit (U): the amount of enzyme required to catalyze chitosan to produce 1 μmol reducing sugar per minute. According to the DNS method, the enzyme activity in the liquid medium supernatant of Aspergillus clavatus W-2 strain was 0.53U / ml.

Embodiment 2A

[0085] The extraction of embodiment 2Aspergillus clavatus W-2 bacterial strain total RNA

[0086] The strain was cultured for 4 days, filtered with gauze, and the bacteria were directly stored in liquid nitrogen. Take about 40 mg of the thallus and grind it three times under liquid nitrogen. Then add 1ml Trizol reagent, and transfer to a 1.5ml centrifuge tube after melting. Add 200ul chloroform to the system, shake vigorously, let stand for 5min, and centrifuge at 12000rpm for 15min. Carefully take the supernatant into a new centrifuge tube, add an equal volume of isopropanol, let stand for 5 minutes, and centrifuge at 12,000 rpm for 10 minutes. Pour off the supernatant, add 1ml of ethanol with a volume concentration of 75% to the precipitate, and centrifuge at 7500rpm for 5min. Finally, dissolve the precipitate with 20-50ul of ribonuclease-free water. Store at -80°C for later use.

Embodiment 3

[0087] The cloning of embodiment 3csnW2 gene 3' end mRNA sequence

[0088]According to the operation steps in the manual of 3'-Full RACE Core Set Ver.2.0 (Takara Code: D314) of Takara Bioengineering (Dalian) Co., Ltd., the 3'RACEAdaptor was used as the primer, and the total RNA of Aspergillus clavatus W-2 strain was used as the template for reverse reaction. The first strand of cDNA was transcribed and synthesized; the first round of PCR was performed with 3'RACE Outer Primer (TACCGTCGTTCCACTAGTGATTT) and SP Primer (ATGGAYATCGACTGYGAYGG) as primers, and the reaction conditions were: 94°C for 3min, 30 cycles (94°C for 30sec, 55°C for 30sec, 72°C for 1.2min), 72°C for 10min; use 3'RACE Inner Primer (CGCGGATCCTACCGTCGTTCCACTAGTGATTTCACTATAGG) and SP Primer (ATGGAYATCGACTGYGAYGG) as primers for the second round of PCR, and the reaction conditions are: 94°C for 3min, 30 cycles (94°C ℃ 30sec, 58℃ 30sec, 72℃ 1.2min), 72℃ 10min. The two rounds of PCR products were analyzed by 1% agar...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an endo-chitosan enzyme CsnW2 gene sequence and preparation method and application thereof. The invention relates to a soil new isolated bacterial strain Aspergillus clavatus from the endo-chitosan enzyme CsnW2. The invention also provides a method for preparing the novel chitosan enzyme, ie a gene engineering technique, which includes the following steps: cloning the novel chitosan enzyme gene to a pichia yeast expression vector, and obtaining a pichia yeast recombination bacterial strain for heterogenous express of the enzyme. The chitosan enzyme CsnW2 prepared by heterogenous expression of the bacterial strain has high activity at pH 3.5-5.0 and 40-60 DEG C. with Chitosan oligosaccharide preparation function by chitosan degradation. The chitosan enzyme CsnW2 provided by the invention can be widely applied to the chemical industry, the agriculture, the foodstuff, the forage adding, the medicine and other fields, and has large production potential and economic value.

Description

technical field [0001] The invention relates to a gene sequence of an endochitosanase CsnW2, a preparation method and application thereof. The invention also provides the recombinant plasmid and recombinant genetic engineering strain of the endo-chitosanase. The endo-chitosanase CsnW2 of the invention can be widely used in the fields of chemical industry, agriculture, food, feed addition, medicine and the like. Background technique [0002] Chitosan (chitosan), also known as polyglucosamine, chitin, deacetylated chitin, deacetylated chitin, soluble chitin, chitosamine, chitin and polychitosan, etc., the chemical name is poly-β -(1→4)-2-Amino-2-deoxy-D-glucose. Chitosan is a product obtained by deacetylation of chitin. Generally, when the degree of deacetylation of chitin exceeds 50%, it is considered to be chitosan. Chitosan is widely found in the shells of shrimps, crabs, insects, and cell walls of algae and fungi. Due to its large molecular weight and poor water solubi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/14C12N9/42C12N15/56C12N15/63C12P19/26C12R1/66
Inventor 杜昱光张建平曹海龙岳敏黄李淑馨李曙光赵勇刘航
Owner DALIAN INST OF CHEM PHYSICS CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More