Unlock instant, AI-driven research and patent intelligence for your innovation.

Plant tissue specific expression promoter and application of plant tissue specific expression promoter

A promoter and plant technology, applied in the biological field, can solve problems such as complex regulation

Active Publication Date: 2013-08-14
INST OF CROP SCI CHINESE ACAD OF AGRI SCI
View PDF4 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Different types of root-specific expression genes are usually expressed specifically in the cells of special root populations. Therefore, the regulation of gene expression by root-specific promoters is not only affected by different regulatory elements in the promoter, but also by proteins in specific cells. Factors, the regulation is a very complex process

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plant tissue specific expression promoter and application of plant tissue specific expression promoter
  • Plant tissue specific expression promoter and application of plant tissue specific expression promoter
  • Plant tissue specific expression promoter and application of plant tissue specific expression promoter

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Embodiment 1, the acquisition of DNA fragment 1W

[0035] Genomic DNA was extracted from soybean (Wenfeng No. 7, (Glycine max(L.) Merr. National Crop Germplasm Conservation Center, No. ZDD02611) seedling leaves, diluted to 10ng / μL, diluted DNA template 3μL, 2mM dNTP 1.5μL , 1.5 μL each of 2 μM forward and reverse primers (Qs09D-1F: CCCAAGCTTGGG AGTCAATGAAACCGGATGGG (Sequence 2), Qs09D-1R: TCCCCCGGGGGAGGTTGTTCTTGTGATGTT (Sequence 3)), 10×Ex Buffer 2μL, Ex Taa 0.75U, add water to make up to 20μL. Pre-denaturation at 94°C for 5min; denaturation at 94°C for 30s, annealing at 55°C for 30s, extension at 72°C for 90s, 36 cycles; extension at 72°C for 10min.

[0036] The PCR product was detected by electrophoresis, and the results were as follows: figure 1 As shown, wherein, M: 100bp; 1-8 is the amplified product of Wenfeng No. 7, and it can be seen that the PCR amplified product is about 1300bp.

[0037] The PCR product was recovered and ligated to pMD18-T Vector to obta...

Embodiment 2

[0039] Embodiment 2, functional verification and application of promoter 1W

[0040] 1. The acquisition of 1W Arabidopsis

[0041] 1) Acquisition of plant expression vectors

[0042] The plasmid pMD18-T-1W obtained in Example 1 was double digested with HindIII and SmaI, and the resulting digested product (1316bp) was connected to the pBI121 (Clontech Company) vector backbone (about 13.6kb) that was also digested to obtain a ligated Product, the ligation product was transformed into Escherichia coli Top10 competent cells to obtain transformants.

[0043] The plasmid of the transformant was extracted and digested with HindIII and SmaI. As a result, the target fragment of 1316bp was obtained as a positive plasmid.

[0044] The positive plasmid was sent for sequencing, and the result was that the plasmid was a vector obtained by inserting sequence 1 in the sequence table between the HindIII and SmaI restriction sites of pBI121, and the plasmid was named pBI121-1W::GUS.

[0045]...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a plant tissue specific expression promoter and an application of the plant tissue specific expression promoter. A DNA fragment provided by the invention is any one of the following DNA molecules from (1)-(3): (1) a DNA molecule shown in a sequence 1 of a sequence table, (2) a DNA molecule which is hybridized with the DNA molecule in (1) under the strict condition and has the function of a promoter, and (3) a DNA molecule which has more than 90% of homology with the DNA molecule in (1) and has the function of the promoter. Experiments show that the invention provides the DNA fragment which is the promoter, can be highly expressed at roots, hypocotyl (especially the joints of leaves and the hypocotyl), and the joints of the leaves and stems of arabidopsis, and cannot be expressed in the leaves, flowers or pods. Experiments indicate that the promoter is a specific promoter which can be expressed in specific plant tissue, and can play an important role in the artificial control genetic breeding, the expression of related genes of stress resistance and stress tolerance, and the transgenic research on the cultivation of plants with the stress resistance and the stress tolerance.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a plant tissue-specific expression promoter and its application. Background technique [0002] Tissue-specific promoters regulate gene expression only in certain organs or tissues, so they are also called organ or cell-specific promoters. Tissue-specific promoters usually exhibit developmental regulatory properties, and some have inductive activity while specifically expressing. Tissue-specific promoters usually contain several elements that control tissue-specific expression at the same time, and factors such as the type, number, and relative position of these elements work together to determine their expression specificity. The in-depth study of tissue-specific promoters helps to elucidate plant morphology, developmental processes and metabolic pathways, and has a wide range of applications. [0003] Plant roots are responsible for the transportation and absorption of water and n...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/63C12N5/10C12N1/21C12N15/11C12N15/84A01H5/00
Inventor 邱丽娟关荣霞刘林常汝镇夏明月
Owner INST OF CROP SCI CHINESE ACAD OF AGRI SCI