Screening method for anti-HBV compounds
A screening method and compound technology, applied in the fields of molecular biology and biomedicine, to achieve highly specific and targeted effects that are conducive to determination
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Example 1: Construction of the full-length HBV core protein eukaryotic expression plasmid pHBc185 targeting the target sequence HBc-1
[0033] Using pHBV1.3 expressing 1.3 times full-length full-length HBV genome (adw subtype) as a template, the DNA fragment encoding the full-length core protein was cloned and recombined with the pcDNA3.1 plasmid (purchased from Invitrogen), and transformed into E.coli recipient strain DH5α ( Purchased from Tiangen Biochemical Technology Co., Ltd.), after screening and identification, the eukaryotic expression plasmid pHBc185 of the full-length core protein was obtained. Amplification primers are as follows:
[0034] SP / HBc 1 Pst1 (SEQ ID NO: 6)
[0035] 5'-TTTTCTGCAGATGGACATTGACCCGTATAAAGAATTTGGAGC-3',
[0036] ASP / HBc 185 Pst 1 (SEQ ID NO: 7)
[0037] 5'-TTTTCTGCAGCTAACATTGAGATTCCCGAGATTTAGATCTTCTGCGACG-3'.
[0038] PCR reaction procedure such as Figure 9 shown.
[0039] The conversion conditions are as follows:
[0040] 4℃, 3...
Embodiment 2
[0045] Example 2: Construction of the C-terminal truncated HBV core protein eukaryotic expression plasmid pHBc171 for the target sequence HBc-2
[0046] Using the pHBc185 prepared in Example 1 as a template, the carrier fragment pHBCTD was generated by PCR, and the amplification primers were as follows:
[0047] SP / pHBc185 / 1502-1401 (SEQ ID NO: 8)
[0048] 5'-TCGGGAATCTCAATGTTAGCTGC-3',
[0049] ASP / pHBc185 / 1502-1401 (SEQ ID NO: 9)
[0050] 5'-TAGTTTCCGGAAGTGTTGATAAGATAGGGGCATTTG-3',
[0051] A DNA insert fragment encoding the 141-171 amino acids at the C-terminus of the HBV core protein was synthesized, and the sequence was as follows (SEQ ID NO: 10):
[0052] 5'-ACACTTCCGGAAACTACTGTTGTTAGACGACGGGACCGAGGCAGGCAATCTCGGGAATCTCAATGTCCCCTAGAAGAAGAACTCCCTCGCCTCGCAGACGAAGGTCTCAA-3'.
[0053] Using homologous recombination technology, the synthetic fragment was inserted into the above-mentioned carrier fragment pHBCTD produced by PCR, and transformed into E.coli recipient bacteria ...
Embodiment 3
[0061] Example 3: Construction of the C-terminal truncated HBV core protein eukaryotic expression plasmid pHBc163 for the target sequence HBc-3
[0062] A DNA insert fragment encoding the 141-163 amino acids at the C-terminus of the HBV core protein was synthesized, and the sequence was as follows (SEQ ID NO: 11):
[0063] 5’-ACACTTCCGGAAACTACTGTTGTTAGACGACGGGACCGAGGCAGGCAATCTCGGGAATCTCAATGTCCCCTAGAAGAAGAACTCCC-3’
[0064] Using homologous recombination technology, the synthetic fragment was inserted into the above-mentioned carrier fragment pHBCTD produced by PCR, and transformed into E.coli recipient bacteria (same as Example 1). After screening and identification, the C-terminal truncated core protein eukaryotic was obtained. Expression plasmid pHBc163.
[0065] The PCR reaction procedure was the same as in Example 2.
[0066] The homologous recombination reaction conditions were the same as in Example 2.
[0067] Transformation conditions are the same as in Example 1. ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More