Glycosyltransferase gene and application thereof

A technology of glycosyltransferase and gene, which is applied in the field of genetic engineering to achieve the effect of reducing production cost and simplifying the production process

Inactive Publication Date: 2013-10-16
SUN YAT SEN UNIV
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] In recent years, metagenomics has made remarkable progress in the study of new biocatalysts. Researchers have used metagenomics technology to screen from different environmental samples There are many biocatalysts with industrial application potential, such as lipase / esterase, amylase, xylanase, cellulase, β-glucosidase, but so far, there is no There are reports of using glycosyltransferases to synthesize galacto-oligosaccharides from lactose and obtaining glycosyltransferases from marine samples by metagenomic technology

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Glycosyltransferase gene and application thereof
  • Glycosyltransferase gene and application thereof
  • Glycosyltransferase gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Example 1 Construction of marine silt metagenomic library and screening of positive clones

[0045] (1) Extraction of genomic DNA from marine sludge samples: Weigh 5 g of sample into a 50 mL centrifuge tube, add 13.5 mL

[0046] DNA extraction buffer, vigorously shake and mix, then add 100 μL proteinase K (10 mg / ml), invert repeatedly 5-6 times, then place in 37 °C water bath for 30 min, then add 1.5 mL 20% SDS, 65 °C water bath for 2 After centrifugation at 6,000 g for 10 min (upside down several times every 15 min), take the supernatant, extract twice with an equal volume of chloroform, centrifuge at 10,000 g for 20 min, take the supernatant, and add 0.6 times the volume of isopropyl Alcohol, left at room temperature for 1 h, centrifuged at 16,000 g for 20 min, discarded the supernatant, added 5 mL of pre-cooled 70% ethanol, centrifuged at 16,000 g for 5 min to collect the DNA precipitate, air-dried and dissolved with appropriate amount of TE buffer.

[0047] T...

Embodiment 2

[0056] Example 2 Glycosyltransferase gene Glyt7-2 Expression in E. coli

[0057] (1) PCR amplification of the glycosyltransferase gene: design primers according to the sequence of the above glycosyltransferase gene, and introduce a gene that can be inserted into the expression vector pET32a (+) (Novagen) Eco R I and Hin d III double restriction site, the primer sequence is as follows:

[0058] Glyt7-2 F: TGGCACCCGAATTCATGCGGATCGCGTTCCATAAGC

[0059] Glyt7-2 R: CCGTCGATAAGCTTTCATGCCGCGCCAATTGGGAAG

[0060] pUC19lacZ– Glyt7-2 template 5 ng 5×Buffer 1 μl dNTPs (2.5 mM) 4 μl Glyt7-2 F (20 μM) 1 μl Glyt7-2 R (20 μM) 1 μl PrimerSTAR (2.5 U / μl) 0.5 μl Make up to 50 μl with water

[0061] The PCR reaction conditions are as follows:

[0062] The first stage: pre-denaturation at 94°C for 3 min; the second stage: 30 cycles of denaturation at 94°C for 30 sec, annealing at 65°C for 45 sec, and extension at 72°C...

Embodiment 3

[0069] Example 3 Preparation and Purification of Recombinant Glycosyltransferase Glyt7-2 Crude Enzyme Solution

[0070] Inoculate the recombinant strains preserved in Example 2 in LB liquid medium containing 100 μg / ml ampicillin, and culture with vigorous shaking at 37°C until OD 600 =0.6~1.0, add the final concentration of 0.1~1.2 mM (IPTG), induce expression at 18~37 ℃ for 6~14 h, collect the bacteria, crush and centrifuge to obtain the crude enzyme solution. The crushed crude enzyme solution was purified with HisBind Purification Kit (Novagen) and operated according to the instructions. SDS–PAGE electrophoresis analysis showed (attached figure 1 ), the purified recombinant glycosyltransferase is a single band with a molecular weight of about 64.5 kDa (of which 18 kDa is the fusion protein tag on the expression vector), which is consistent with the theoretically predicted protein molecular weight (46.5 kDa).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a glycosyltransferase gene, which is derived from a marine mud metagenome library, wherein the whole length of the nucleotide sequence of the gene is 1332 bp, the gene encodes 443 amino acids, the nucleotide sequence and the amino acid sequence are respectively represented by SEQIDNO.1 and SEQIDNO.2, and the gene can be efficiently and solubly expressed in an escherichia coli expression system. Enzymology characteristics of the recombinant enzyme expressed by the gene comprise that: o-nitrophenol-beta-D-galactoside is adopted as a substrate, the optimum temperature of the enzyme is 45 DEG C, the optimum pH value of the enzyme is 7.0, and the enzyme has good stability at a temperature of less than 45 DEG C and under a pH value range of 6.0-8.0. The recombinant glycosyltransferase has characteristics of high transglycosylation activity and glucosidic bond hydrolysis activity, wherein a galacto-oligosaccharide yield can be up to 49.47% after carrying out a reaction for 12 h at a temperature of 40 DEG C under the pH value of 7.0 by adopting a 30% (w / v) lactose solution as a substrate.

Description

[0001] technical field [0002] The invention belongs to the field of genetic engineering, and in particular relates to a new gene of a glycosyltransferase, in particular to the application of the glycosyltransferase in biological preparation of galacto-oligosaccharides. Background technique [0003] Functional oligosaccharides have become important functional food ingredients because of their unique physiological functions, and have attracted worldwide attention. In recent years, people's demand for health food such as functional oligosaccharides is increasing. Galacto-oligosaccharides (GOS), also known as oligosaccharides, is a naturally occurring functional oligosaccharide, and it is also one of the most widely recognized and safest oligosaccharides among many functional oligosaccharides , which is a type of low-polymerized sugar formed by linking 1 to 9 galactose residues on the galactose or glucose side of the lactose molecule. Galactooligosaccharides have health fu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/10C12N15/54C12N15/70C12N1/21C12P19/18C12R1/19
CPCY02P20/52
Inventor刘玉焕汪思迪李良曹立创童铃郭耿珊
OwnerSUN YAT SEN UNIV