Sugarcane genome endogenous reference gene isopentenyl diphosphate delta-isomerase gene PCR (polymerase chain reaction) primer sequences and amplification method
A technology of prenyl diphosphate and internal standard gene, which is applied in the direction of recombinant DNA technology, DNA / RNA fragments, DNA preparation, etc., can solve the problem that the copy number has no research reports, etc., and achieves easy determination, wide applicability, highly specific effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] (1) PCR amplification of sugarcane prenyl diphosphate δ-isomerase gene
[0022] The sequence of PCR primers for prenyl diphosphate delta-isomerase gene is: ScIDI2-F : GCATCATAGCGTCCAGGTCTA; ScIDI2-R : CCATCAGCATCAGTTTTTGTG.
[0023] PCR reaction system: 1.0 U Taq DNA polymerase, 1×PCR buffer solution, 0.25 mM dNTP, 3.0 mM MgCl2, primers ScIDI2-F and ScIDI2-R Each 0.25 mM, DNA template 25 ng, the total volume of the reaction system is 25??l;
[0024] PCR amplification conditions: pre-denaturation at 95°C for 6 min; denaturation at 94°C for 30 s; annealing at 56°C for 30 s, extension at 72°C for 40 s, a total of 35 cycles, and a final extension at 72°C for 7 min.
[0025] (2) Electrophoresis detection of PCR product of sugarcane prenyl diphosphate δ-isomerase gene and analysis of product specificity and generality
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com