Primer probe and method for performing real-time fluorescent polymerase chain reaction (PCR) detection on origin ingredients of raccoon
A technology of real-time fluorescence and source components, applied in the field of food inspection, to achieve the effects of improving the food inspection system, increasing protection, good sensitivity and specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] 1. Primers and probes used:
[0034] Select the mitochondrial d-loop gene of raccoon dogs as the object, design and synthesize specific amplification primers and probes for real-time fluorescent PCR;
[0035] Real-time fluorescent PCR primer and probe sequences include:
[0036] Upstream primer P1: CTATACCTGGCATCTGGTTCTTACC;
[0037] Downstream primer P2: GTCCCATTTGAGTGGATTAGTAGGA;
[0038] Probe: CAGGGCCATGAACTCCCTCCATCC, the 5. end of the probe is labeled with the reporter fluorescent dye FAM, and the 3. end is labeled with the quenching fluorescent dye eclipse.
[0039] 2. The extraction and purification of sample DNA are carried out according to the following steps:
[0040] a. Use a tissue homogenizer to beat the meat sample containing raccoon-derived components into a homogenate,
[0041] Take 100 mg of homogenate and add 1.0 mL of CTAB lysate and 50 μL of proteinase K solution, vortex for 30 s, invert and mix 5 times, and place in a 65°C water bath overnight ...
Embodiment 2
[0063] Take raccoon meat, raccoon meat products, beef, pork, mutton, cat meat, dog meat, venison, camel meat, horse meat, donkey meat, rabbit meat, chicken, duck, goose, mink, fox and other 17 kinds of animal DNA In real-time fluorescent PCR detection, there is no amplification signal in samples that do not contain raccoon dog-derived components, but only raccoon dog meat has amplification signals. Example 2 shows that the primers and probes of the present invention have good specificity. see results figure 2 .
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap