Unlock instant, AI-driven research and patent intelligence for your innovation.

Insulin-Fc fusion protein

A technology of fusion protein and insulin, which is applied in the field of fusion protein and its preparation, can solve the problems of inconvenient transportation and storage, inability to cure diseases, and short half-life of storage, etc., to improve pharmacokinetic performance, reduce medication pain, and reduce intervals the effect of time

Active Publication Date: 2014-01-15
SHANGHAI SINOMAB BIOTECHNOLOGY CO LTD
View PDF4 Cites 70 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Furthermore, current treatments for type 2 diabetes do not cure the disease, but merely delay the time until the patient needs insulin therapy
[0003] Natural or recombinant proteins such as insulin usually have a short half-life in aqueous solution. Due to the instability of these molecular preparations, they must be stored in a freeze-dried manner, which brings inconvenience to transportation and storage.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Insulin-Fc fusion protein
  • Insulin-Fc fusion protein
  • Insulin-Fc fusion protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1: Construction and expression of insulin-Fc fusion protein

[0024] Isolate healthy human lymphocytes with lymphocyte separation fluid, extract total RNA with Trizol reagent (Invitrogen company product), according to literature (Cell, 1980, 22:197-207) and literature (Nucleic Acids Research, 1982, 10: 4071-4079 ) respectively designed primers FCM SENSE: GAGCCCAAATCTTGTGACAAAACTCACACATGCCCACCGTGCCCAGCACCTGAAGCAGCAGGGGGACCGTCAGTCTTCC and FCANTISENSE: CGAATTCTCATTTACCCGGAGACAGG to amplify the Fc region of the antibody, and introduced mutation points into FCM SENSE to mutate the two leucines of H235 and H236 into two alanines. All the reactions were hot-started, and the reaction conditions were: 94°C for 5 minutes; 94°C for 45 seconds, 60°C for 45 seconds, 72°C for 1 minute and 10 seconds, 30 cycles; 72°C for 10 minutes. Insulin B chain, C is 1, GGGPGKR, 2, GGGPQT, 3, GGGPGAG, 4, AAGGGPSVR) and A chain genes were synthesized from the whole gene, and connected to T...

Embodiment 2

[0026] Example 2: Detection of insulin-Fc fusion protein affinity

[0027] ELISA identifies the binding activity of insulin-Fc fusion protein: the soluble insulin receptor protein (Abnova company product) is diluted to 2ug / ml with 0.05mmol / L sodium carbonate.Sodium bicarbonate buffer solution (pH 9.6), 100ul / hole, 4 °C overnight. After blocking with 3% skimmed milk at room temperature for 2 hours, different concentrations of insulin-Fc fusion protein and control antibody 301 were added, 100ul / well, and 3 parallel wells were taken for each concentration, and incubated at room temperature for 2 hours. Discard the supernatant, wash with PBS three times, add HRP-labeled mouse anti-human IgG monoclonal antibody (product of DAKO Company) diluted according to the titer, 50 μl / well, and incubate at room temperature for 45 minutes. After fully washed with PBS, the OPD was protected from light for color development, and 2mol / L H2SO4 was added to terminate the reaction, and the absorba...

Embodiment 3

[0029] Embodiment 3: Detection of the affinity constant of insulin-Fc fusion protein with biocore

[0030] Biacore T100 was used to detect the binding activity of each insulin-Fc fusion protein to insulin receptor. The insulin receptor was connected to the CM5 chip by the method of amino coupling, and then the insulin receptor and The binding activity of each insulin-Fc fusion protein, the flow rate of the flow cell is 30ul / min. The insulin receptor is coupled to a response value of 1500RU, and insulin and each insulin-Fc fusion protein (50ug / ml, 25ug / ml, 12.5ug / ml, 6.25ug / ml, 3.125ug / ml, 1.56ug / ml, 0.78ug / ml, 0.39ug / ml) the signal activity of interacting with the insulin receptor at different concentrations. The binding time was 420 s, the dissociation time was 600 s, and the regeneration time was 60 s with 10 mM glycine. The baseline was stable, and 1.56 ug / ml was used as the repeated concentration to ensure the regeneration activity of the chip. According to the calculat...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to a biological technology field, more concretely discloses an insulin-Fc fusion protein, a preparation method and applications thereof. The insulin-Fc fusion protein provided by the invention has a long half life, can reduce interval time of insulin usage, and can reduce medicine use pain.

Description

technical field [0001] The invention belongs to the field of biotechnology, and more specifically, the invention discloses a fusion protein, its preparation method and application. Background technique [0002] Diabetes is a growing epidemic that is estimated to affect more than 300 million people by 2025, and there is an urgent need for an effective drug treatment. Type 2 diabetes accounts for 90-95% of all cases. Complications resulting from persistently elevated blood glucose levels include cardiovascular disease, nephropathy, neuropathy, and retinopathy. Furthermore, in the advanced stages of type 2 diabetes, the beta cells of the pancreas die, which stops making insulin. Current treatments for diabetes can have a variety of harmful side effects, including hypoglycemia and weight gain. Furthermore, current treatments for type 2 diabetes do not cure the disease, but merely delay the time until patients need insulin therapy. [0003] Natural or recombinant proteins suc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00C12N15/62A61K47/48A61K38/28A61P3/10
Inventor 顾娜娜郭怀祖
Owner SHANGHAI SINOMAB BIOTECHNOLOGY CO LTD