Unlock instant, AI-driven research and patent intelligence for your innovation.

Gene-recombinant saccharomyces cerevisiae for efficiently adsorbing uranium contained in water solution and construction method thereof

A technology of Saccharomyces cerevisiae and genetic recombination, applied in the field of environmental biotechnology applications, achieving the effect of simple construction method and good application prospects

Inactive Publication Date: 2014-01-22
EAST CHINA UNIV OF TECH
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] So far, there have been no relevant reports at home and abroad on whether expressing MTs on the outer membrane of Saccharomyces cerevisiae can increase the biosorption capacity of uranium (VI)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene-recombinant saccharomyces cerevisiae for efficiently adsorbing uranium contained in water solution and construction method thereof
  • Gene-recombinant saccharomyces cerevisiae for efficiently adsorbing uranium contained in water solution and construction method thereof
  • Gene-recombinant saccharomyces cerevisiae for efficiently adsorbing uranium contained in water solution and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0028] 1. Construction and identification of the expression vector pYD-MT

[0029] 1. Target sequence design and synthesis

[0030] Search the Genebank database to obtain the coding sequence of the human liver metallothionein gene. Analyze the codon usage of Saccharomyces cerevisiae, replace rare codons with preferred codons, and add xho I and Bam HI restriction site to obtain the modified metallothionein gene (MT) sequence:

[0031] GGATCCATGGACCCAAACTGCTCCTGCGCTACTGGTGGTTCCTGCACCTGCACTGGTTCCTGCAAATGCAAAGAATGCAAATGCACCTCCTGCAAGAAGTCTTGCTGCTCCTGCTGCCCAATGTCTTGTGCTAAGTGTGCTCAAGGTTGCATCTGCAAAGGTGCATCAGAAAAGTGCTCTTGCTGTGCTCTCGAG

[0032] According to the above sequence, the metallothionein gene was synthesized and modified by Shanghai Sangong Biotechnology Co., Ltd., and the MT gene was connected to the plasmid pUC57 by conventional methods to obtain the recombinant plasmid pUC57-MT; to prepare E. coli DH5α competent cells, heat shock method The recombinant plasmid was tran...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses gene-recombinant saccharomyces cerevisiae for efficiently adsorbing uranium contained in a water solution and a construction method thereof. The gene-recombinant saccharomyces cerevisiae is constructed by carrying out codon reconstruction on a human liver metallothionein gene, recombining with a saccharomyces cerevisiae expression vector and transferring into a saccharomyces cerevisiae cell for correct expression. The gene-recombinant saccharomyces cerevisiae disclosed by the invention effectively increases the adsorption capacity of the saccharomyces cerevisiae cell on uranium (VI), has the characteristics of low adsorption cost and biomass reusability without secondary pollution and has positive promoting effect on the aspects of uranium pollution degree reduction and uranium resource recovery.

Description

technical field [0001] The invention relates to a gene recombinant Saccharomyces cerevisiae capable of efficiently absorbing uranium (VI) in aqueous solution, which belongs to the application field of environmental biotechnology. Background technique [0002] Biosorption refers to the process of making heavy metal ions adsorbed by biological cells through a series of biochemical actions. Studies have shown that a variety of microorganisms are used for the biosorption of heavy metal ions, including algae, bacteria, fungi, and yeast. Among them, Saccharomyces cerevisiae ( Saccharomyces cerevisiae ) has been shown for Cu 2+ 、Cr 3+ , Pb 2+ , Hg 2+ 、Cd 2+ 、As 3+ And many other metal ions have strong adsorption capacity, and at the same time have the excellent characteristics of safety, easy cultivation and growth. Microbial adsorption has low cost, high efficiency, reusable biomass, and no secondary pollution. It has broad application prospects in treating uranium-contain...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/19C12N15/12C12N15/81B01J20/00B01J20/30B01D15/08C12R1/865
Inventor 李敏梁波张志斌徐琼于梁梁
Owner EAST CHINA UNIV OF TECH