Gene-recombinant saccharomyces cerevisiae for efficiently adsorbing uranium contained in water solution and construction method thereof
A technology of Saccharomyces cerevisiae and genetic recombination, applied in the field of environmental biotechnology applications, achieving the effect of simple construction method and good application prospects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0028] 1. Construction and identification of the expression vector pYD-MT
[0029] 1. Target sequence design and synthesis
[0030] Search the Genebank database to obtain the coding sequence of the human liver metallothionein gene. Analyze the codon usage of Saccharomyces cerevisiae, replace rare codons with preferred codons, and add xho I and Bam HI restriction site to obtain the modified metallothionein gene (MT) sequence:
[0031] GGATCCATGGACCCAAACTGCTCCTGCGCTACTGGTGGTTCCTGCACCTGCACTGGTTCCTGCAAATGCAAAGAATGCAAATGCACCTCCTGCAAGAAGTCTTGCTGCTCCTGCTGCCCAATGTCTTGTGCTAAGTGTGCTCAAGGTTGCATCTGCAAAGGTGCATCAGAAAAGTGCTCTTGCTGTGCTCTCGAG
[0032] According to the above sequence, the metallothionein gene was synthesized and modified by Shanghai Sangong Biotechnology Co., Ltd., and the MT gene was connected to the plasmid pUC57 by conventional methods to obtain the recombinant plasmid pUC57-MT; to prepare E. coli DH5α competent cells, heat shock method The recombinant plasmid was tran...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com