Anti-influenza-virus broad-spectrum-neutrality neutralizing molecule 3E1
A technology combining molecules and influenza viruses, applied in the direction of antiviral agents, antiviral immunoglobulins, antibodies, etc., can solve the problems of restricting the large-scale use of chemical small molecule drugs and not recommending alkylamine drugs, etc., to achieve prevention or treatment Effects of Multiple Influenza Virus Infections
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0176] Example 1, HA-specific memory B cells
[0177] Using FITC-CD19 / APC-IgG / Cy3-HA as specific markers, several HA-specific B cells were obtained.
Embodiment 2
[0178] Embodiment 2, antibody gene
[0179] RT-PCR and Nested-PCR method to obtain antibody heavy and light chain variable region genes, the molecular weight is about 400bp, β-actin is used as an internal reference (343bp), and the electrophoretic pattern is shown in figure 2 , image 3 and Figure 4 . The variable regions of heavy and light chain genes derived from the same B cell antibody were connected to T vectors, sequenced and constructed for expression vectors.
[0180] The sequence of the 3E1 heavy chain variable region gene is as follows (SEQ ID NO: 1):
[0181] CAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGA AGCCTTCGGAGACCCTGTCCCTCACGTGCAGTGTCTCT TGGATCTGGATCCGGCAGCCCGCCGGGAAGGGACTGGAGTGGATTGGGCGT AACTACAACCCCTCCTCAGGAGTCGAGTCACCATGTCGGTGGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGACCTCTGTGACCGCCGCGGACACGGCCGTGTATTACTGT TGGGGCCAGGGAACCCTGGTCACCGTCTCCTCA
[0182] Remarks: The sequences marked with double underlines are heavy chain gene CDR1 (SEQ ID NO: 5), CDR2 (SEQ ID NO: ...
Embodiment 3
[0192] Embodiment 3, antibody expression
[0193] The results of ELISA showed that the fully human antibody was successfully expressed, and its concentration was 200-300 μg / ml. Because the expression vector already contains the constant region of the heavy and light chain, the 293T cells transfected with the empty vector can also express the constant region of the heavy and light chain of the antibody, see Figure 5 .
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap