Deoxyribonucleic acid (DNA) sequence of cricetulus barabensis
A hamster and black line technology, applied in the field of black line hamsters, can solve the problem of less research on molecular identification of rodents, and achieve the effect of ensuring accuracy and reliability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] 1. Collection and preservation of specimens
[0034] The specimens were collected by the mouse trap method, and the collected specimens were directly dissected after alcohol disinfection, and the livers were preserved in 75% alcohol and brought back.
[0035] 2. DNA template preparation
[0036] The black-lined hamster DNA was extracted using TIANGEN DP304-03 kit, and the extracted DNA samples were stored at -80°C for future use.
[0037] 3. Primer synthesis
[0038] The primers used in this example are as follows:
[0039] Forward primer 5'ACTTCTGGGTGTCCAAAGAATCA3'
[0040] Reverse primer 5'CCTACTCRGCCATTTTACCTATG3'
[0041] 4. PCR amplification
[0042] The PCR reaction system of this embodiment is shown in Table 1.
[0043] Table 1 Black-lined hamster COI gene PCR reaction system (50 μL system)
[0044] Element
Volume (μL)
template
3-4
forward primer
2
reverse primer
2
Premix
25
wxya 2 o
17...
Embodiment 2
[0054] The morphological identification characteristics of the black-lined hamster are as follows: 1 pair of upper incisors; the angular process of the mandible is on the same vertical plane as the alveolar of the lower incisors, and is located below the alveolar, the front hole of the frame is small, and the coronoid process is obvious; Individual species are larger, the tail section is round or flat, covered with hairs or small scales, 3 / 3 of each side of the cheek teeth; Hair bundles are formed, the molar odontoid process of young rats is tumor-like, and the adult odont process is ground flat. There is a buccal pouch on each side of the oral cavity, and the odont process is opposite to each other; Most of them are hairless, the tail is hairy, and the length of the tail exceeds the length of the hind feet; the hair color on the back and ventral surface of the body does not form a wavy boundary on the side of the body; the body is small, and the body length does not exceed 140...
Embodiment 3
[0056] Using the identification method in combination of Example 1 and Example 2, the vole was identified, and the black-lined hamster was quickly identified.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap