Check patentability & draft patents in minutes with Patsnap Eureka AI!

Deoxyribonucleic acid (DNA) sequence of cricetulus barabensis

A hamster and black line technology, applied in the field of black line hamsters, can solve the problem of less research on molecular identification of rodents, and achieve the effect of ensuring accuracy and reliability

Inactive Publication Date: 2014-04-02
CHINESE ACAD OF INSPECTION & QUARANTINE
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Mitochondrial COI gene is the most widely used molecular marker in rodent identification research. At present, there are few researches on rodent molecular identification in China. This invention intends to provide a scientific basis for rapid identification of black-lined hamsters

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Deoxyribonucleic acid (DNA) sequence of cricetulus barabensis
  • Deoxyribonucleic acid (DNA) sequence of cricetulus barabensis
  • Deoxyribonucleic acid (DNA) sequence of cricetulus barabensis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] 1. Collection and preservation of specimens

[0034] The specimens were collected by the mouse trap method, and the collected specimens were directly dissected after alcohol disinfection, and the livers were preserved in 75% alcohol and brought back.

[0035] 2. DNA template preparation

[0036] The black-lined hamster DNA was extracted using TIANGEN DP304-03 kit, and the extracted DNA samples were stored at -80°C for future use.

[0037] 3. Primer synthesis

[0038] The primers used in this example are as follows:

[0039] Forward primer 5'ACTTCTGGGTGTCCAAAGAATCA3'

[0040] Reverse primer 5'CCTACTCRGCCATTTTACCTATG3'

[0041] 4. PCR amplification

[0042] The PCR reaction system of this embodiment is shown in Table 1.

[0043] Table 1 Black-lined hamster COI gene PCR reaction system (50 μL system)

[0044] Element

Volume (μL)

template

3-4

forward primer

2

reverse primer

2

Premix

25

wxya 2 o

17...

Embodiment 2

[0054] The morphological identification characteristics of the black-lined hamster are as follows: 1 pair of upper incisors; the angular process of the mandible is on the same vertical plane as the alveolar of the lower incisors, and is located below the alveolar, the front hole of the frame is small, and the coronoid process is obvious; Individual species are larger, the tail section is round or flat, covered with hairs or small scales, 3 / 3 of each side of the cheek teeth; Hair bundles are formed, the molar odontoid process of young rats is tumor-like, and the adult odont process is ground flat. There is a buccal pouch on each side of the oral cavity, and the odont process is opposite to each other; Most of them are hairless, the tail is hairy, and the length of the tail exceeds the length of the hind feet; the hair color on the back and ventral surface of the body does not form a wavy boundary on the side of the body; the body is small, and the body length does not exceed 140...

Embodiment 3

[0056] Using the identification method in combination of Example 1 and Example 2, the vole was identified, and the black-lined hamster was quickly identified.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a deoxyribonucleic acid (DNA) sequence of cricetulus barabensis. In order to provide a method for quickly identifying cricetulus barabensis, the rat species are identified by a morphological characteristics identification method, and COI gene sequences of the species are obtained. The invention also provides a DNA standard gene for detecting the cricetulus barabensis, a primer and a kit thereof. The cricetulus barabensis is identified by adopting the traditional morphological identification combined with a molecular classification method, so that the accuracy and the reliability of species identification can be ensured.

Description

technical field [0001] The present invention relates to the black-lined hamster, in particular to the DNA sequence of the black-lined hamster. Background technique [0002] Black-lined hamster (Cricetulus Barabensis) belongs to the hamster family (Cricetidae), hamster subfamily, hamster genus (Cricetulus). Black-lined hamsters are also known as moving warehouses, small hamsters, cheek mice, and tattooed hamsters. Abroad, it is mainly distributed in Mongolia and Russia; in China, it is mainly distributed in Hebei, Shanxi, Inner Mongolia, Heilongjiang, Jilin, Liaoning, Shandong, Jiangsu, Anhui, Henan, Hunan, Hubei, Shaanxi, Ningxia, Gansu and other places. Black-lined hamsters can transmit diseases such as plague, leptospirosis, and tick-borne typhus. At the same time, the black-lined hamster has also been widely used in many fields such as cytogenetics, radiation genetics, experimental tumors and molecular biology. [0003] For a long time, the identification of rodents ma...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/12C12N15/11
CPCC12Q1/6888
Inventor 张晓龙曹晓梅张玲王静李明乔舜王海玲刘润吉
Owner CHINESE ACAD OF INSPECTION & QUARANTINE
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More