D-lactate dehydrogenase gene b116812S as well as preparation method and application thereof
A bll6812s-1, amino acid technology, applied in the field of crop genetics and breeding
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0096] Example 1: Synthesis of D-amino acid dehydrogenase gene bll6812S derived from high-efficiency nitrogen-fixing soybean bradyrhizobium by gene synthesis
[0097] Using gene synthesis [Xiong et al., Nucl Acids Res, 2004, 32:e98] to clone the D-amino acid dehydrogenase gene (bll6812) derived from the high-efficiency nitrogen-fixing Bradyrhizobium soybean strain USDA110, the amino acid of the bll6812 gene was maintained On the basis of keeping the sequence unchanged, according to the plant preference code, the D-amino acid dehydrogenase gene bll6812S encoding the high-efficiency nitrogen-fixing bradyrhizobium soybean was re-synthesized, and the synthetic primers bll6812S-1 to bll6812S-32 of the bll6812S gene were as follows:
[0098] bll6812S-1:
[0099] GAA,GGA,TCC ATGCCAGAGG GTCGTCACGT CGCTATCATC GGTGCTGGTG CTGTCGGTGTCATCTCCGCT
[0100] bll6812S-2:
[0101] CGATCAGAGT GACACGATGA CCCTCACGCA GAGCCTCGAT AGCGGAGATG ACACCGACAG
[0102] bll6812S-3:
[0103] TCATCGTGTC ACTCTG...
Embodiment 2
[0166] Example 2: Construction of efficient nitrogen-fixing soybean bradyrhizobium D-amino acid dehydrogenase gene bll6812S gene expression vector
[0167] The PCR product was double-digested with BamHI and SacI respectively, the DNA fragment was recovered with 1% agarose gel, and the recovered bll6812S gene fragment was ligated with the 1301 plasmid containing double 35S promoters by T4DNA ligase, identified by enzyme digestion and sequence analysis Obtained the recombinant plasmid AH752 containing D-amino acid dehydrogenase gene bll6812S gene, such as figure 1 shown. The expression vector also contains a GUS reporter gene and a kanamycin resistance marker gene with an intron, the vector such as figure 1 shown.
Embodiment 3
[0168] Embodiment 3: Agrobacterium cultivation
[0169] The recombinant plasmid was introduced into Agrobacterium by electric shock method. Pick Agrobacterium tumefaciens LBA4404 single bacteria into 25mL YEB medium (50mg / L rifampicin) for overnight culture, transfer 5mL of bacterial liquid to 100mL YEB medium (50mg / L rifampicin), culture until OD600=0.7 -0.8, place the bacterial solution on ice for 10 minutes, centrifuge at 5000 rpm for 10 minutes, and collect the bacterial cells at 4°C, add 100 mL of sterile double distilled water to wash twice. Add 4mL of 10% glycerol to suspend the bacteria and transfer to a 50ml centrifuge tube. Centrifuge at 5500rpm for 10min at 4°C. Collect the bacteria, add 500 μL of 10% glycerol to suspend the bacteria, and transfer to a 1.5ml centrifuge tube to obtain Agrobacterium competent cells. Take 70 μL of the Agrobacterium competent cells prepared above, add 1 μL of the recombinant plasmid AH752, mix well with a yellow pipette tip with the ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



