Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A d-amino acid dehydrogenase gene bll6812s and its preparation method and application

A bll6812s, amino acid technology, applied in the field of D-amino acid dehydrogenase gene bll6812S and its preparation

Active Publication Date: 2016-05-18
SHANGHAI ACAD OF AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In recent years, DAAO has been used to create glyphosate-resistant plants, but there is no report on the application of D-amino acid dehydrogenase genes to cultivate glyphosate-resistant plants

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A d-amino acid dehydrogenase gene bll6812s and its preparation method and application
  • A d-amino acid dehydrogenase gene bll6812s and its preparation method and application
  • A d-amino acid dehydrogenase gene bll6812s and its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0096] Example 1: Synthesis of D-amino acid dehydrogenase gene bll6812S derived from high-efficiency nitrogen-fixing soybean bradyrhizobium by gene synthesis

[0097] Using gene synthesis method [Xiongetal., NuclAcidsRes, 2004, 32:e98] to clone the D-amino acid dehydrogenase gene (bll6812) derived from the high-efficiency nitrogen-fixing soybean Bradyrhizobium strain USDA110, while keeping the amino acid sequence of the bll6812 gene unchanged Based on the plant preference code, the D-amino acid dehydrogenase gene bll6812S encoding the high-efficiency nitrogen-fixing Bradyrhizobium soybean was re-synthesized, and the synthetic primers bll6812S-1 to bll6812S-32 of the bll6812S gene were as follows:

[0098] bll6812S-1:

[0099] GAA,GGA,TCCATGCCAGAGGGTCGTCACGTCGCTATCATCGGTGCTGGTGCTGTCGGTGTCATCTCCGCT

[0100] bll6812S-2:

[0101] CGATCAGATGTGACACGATGACCCTCACGCAGAGCCTCGATAGCGGAGATGACACCGACAG

[0102] bll6812S-3:

[0103] TCATCGTGTCACTCTGATCGACCCAGGTGAGCCAGGTGGTGAGCAGGCTGCTTCCTA...

Embodiment 2

[0166] Example 2: Construction of efficient nitrogen-fixing soybean bradyrhizobium D-amino acid dehydrogenase gene bll6812S gene expression vector

[0167] The PCR product was double-digested with BamHI and SacI respectively, the DNA fragment was recovered with 1% agarose gel, and the recovered bll6812S gene fragment was ligated with the 1301 plasmid containing double 35S promoters by T4DNA ligase, identified by enzyme digestion and sequence analysis Obtained the recombinant plasmid AH752 containing D-amino acid dehydrogenase gene bll6812S gene, such as figure 1 shown. The expression vector also contains a GUS reporter gene and a kanamycin resistance marker gene with an intron, the vector such as figure 1 shown.

Embodiment 3

[0168] Embodiment 3: Agrobacterium cultivation

[0169] The recombinant plasmid was introduced into Agrobacterium by electric shock method. Pick Agrobacterium tumefaciens LBA4404 single bacteria into 25mL YEB medium (50mg / L rifampicin) for overnight culture, take 5mL of bacterial liquid and transfer to 100mLYEB medium (50mg / L rifampicin), culture until OD600=0.7-0.8 , place the bacterial solution on ice for 10 minutes, centrifuge at 5000 rpm for 10 minutes, and collect the bacterial cells at 4°C, add 100 mL of sterile double distilled water to wash twice. Add 4mL of 10% glycerol to suspend the bacteria and transfer to a 50ml centrifuge tube. Centrifuge at 5500rpm for 10min at 4°C. Collect the bacteria, add 500 μL of 10% glycerol to suspend the bacteria, and transfer to a 1.5ml centrifuge tube to obtain Agrobacterium competent cells. Take 70 μL of the Agrobacterium competent cells prepared above, add 1 μL of the recombinant plasmid AH752, mix well with a yellow pipette tip w...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a D-lactate dehydrogenase gene b116812S derived from a high-efficiency nitrogen fixation bradyrhizobium japonicum as well as a preparation method and application of the D-lactate dehydrogenase gene b116812S. A nucleotide sequence of the D-lactate dehydrogenase gene b116812S is shown in SEQ ID No.1, and an amino acid sequence coded by the D-lactate dehydrogenase gene b116812S is shown in SEQ ID No.2. The D-lactate dehydrogenase gene b116812S is prepared by reconstructing a D-lactate dehydrogenase gene b116812 derived from the high-efficiency nitrogen fixation bradyrhizobium japonicum according to a plant preferred codon and by using a gene synthesis method. The D-lactate dehydrogenase gene b116812S is converted into arabidopsis thaliana to obtain a transgenosis arabidopsis thaliana, and the performance of the transgenosis arabidopsis thaliana resisting glyphosate is remarkably superior to that of wild type arabidopsis thaliana, and can be applied to glyphosate-resisting crop breeding.

Description

technical field [0001] The invention belongs to the field of crop genetics and breeding, and specifically relates to a D-amino acid dehydrogenase gene bll6812S derived from high-efficiency nitrogen-fixing soybean bradyrhizobium and its preparation method and application. Background technique [0002] Glyphosate (Glyphosate) is also known as: Zhencao Ning, Roundup, etc., because of its stable physical and chemical properties, high efficiency, broad spectrum, low toxicity, low residue, easy to decompose, does not damage the soil environment, and is effective for most plants. Since it was successfully developed by Monsanto in 1971, it has become the largest herbicide sold in the world. Therefore, glyphosate has also become the first choice for research on herbicide-resistant transgenic crops, and glyphosate-resistant transgenic crops are currently the most widely planted transgenic crops in the world. [0003] The toxic mechanism of glyphosate is to competitively inhibit 5-eno...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/53C12N15/10C12N15/84A01H5/00C12R1/41
Inventor 韩红娟姚泉洪彭日荷朱波付晓燕薛永王波田永生许晶高建杰王丽娟韩静李振军
Owner SHANGHAI ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com