A method for co-transformation of oligonucleotide and elimination plasmid for essential gene point mutation of Escherichia coli

A technology of oligonucleotide and Escherichia coli, which is applied in the field of genetic engineering, can solve the problems of gene inactivation, necessary gene modification methods are difficult to implement, and strains cannot survive.

Active Publication Date: 2016-01-20
江苏沃纳生物科技有限公司
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although it has a high mutation efficiency, it is difficult to modify the essential gene by this method, because the introduction of resistance gene will destroy the open reading frame of the essential gene and make the gene inactivated, and the strain cannot survive

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for co-transformation of oligonucleotide and elimination plasmid for essential gene point mutation of Escherichia coli
  • A method for co-transformation of oligonucleotide and elimination plasmid for essential gene point mutation of Escherichia coli
  • A method for co-transformation of oligonucleotide and elimination plasmid for essential gene point mutation of Escherichia coli

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Example 1. Construction of integrative plasmid pLS1755, integrated into E. coli gene and eliminated

[0052] 1.1 Construction of pLS1755

[0053] Design primer LSKD7: 5'-GGG ATCGATGAATTCGGTACCACTAGT TATGGACAGCAAGCGAACCGG-3', (SEQ ID NO.1), ClaI, EcoRI, KpnI and SpeI restriction sites are underlined; LSKD8: 5'-GGG GCTCATGCGAGACCCCATGGGAGCTCCACC GCGGTGGCGGCCGCTCTAGAACTAGT TCAGAAGAACTCGTCAAGAAG-3', (SEQ ID NO.2), XhoI, BsaI, NcoI, SacI, SacII, NotI, BamHI and SpeI restriction sites are underlined. Using pKD4 as a template, LSKD7 and LSKD8 were amplified by PCR to obtain a 1.5kb kanamycin resistance gene neo fragment, which was digested with ClaI-BsaI and then ligated with the 1.4kb vector part obtained by pKD4 digested with ClaI-NcoI and separated , transform the competent cells of BW25141, and obtain the recombinant clone pLSKD2 through screening.

[0054] Design primer NI1: 5'-GGG ACTAGT ttaccctgttatccctaTTATTTCAGGAAAGTTTCGGAG-3', (SEQ ID NO. 3), NI2: 5'-GGG...

Embodiment 2

[0062] Example 2. Point mutation of the essential gene rpsL gene

[0063] The gene number of the rpsL gene on the E. coli genome is b3342, and the design oligonucleotide R507: 5'-G*T*C*A*GACGAACACGGCATACTTTACGCAGCGCGGAGTTCGGTTTT C TAGGAGTGGTAGTATACACGAGTACATACGCCACGTTTTTTGCG-3', (SEQ ID NO.9), * indicates the phosphorothioate linkage, and the underline indicates the mutation site. 5 pmol R507 and 100 ng pLS1755 were electrotransformed as in Example 1, and 100 ampicillin-resistant colonies were amplified and cultured. Primers R509: 5'-CAGGATTGTCCAAAACTCTAC-3', (SEQ ID NO.10), R510: 5'-GGCATCGCCCTAAAATTCGG-3', (SEQ ID NO.11) were designed. Randomly pick 30 clones, use R509 and R510 as primers for colony PCR amplification to get 540bp. The 540bp product was sequenced with R510 as a primer, and two clones with expected point mutations were obtained. Attached is the sequencing map of the rpsL gene point mutation Figure 4 It shows that the 128th base of the open reading frame...

Embodiment 3

[0064] Example 3. Point mutation of the essential gene rpoB gene

[0065] The gene number of rpoB on the E. coli genome is b3987, and the design oligonucleotide R508:

[0066] 5'-A*C*G*T*ACACCCGACTCACTACGGTCGCGTATGTCCAATCGAAACCC T TGAAGGTCCGAACATCGGTCTGATCAACTCTCTGTCCGTGTACGC-3', (SEQ ID NO.12), * is a phosphorothioate linkage, and the underline is a mutation site. 5 pmol R508 and 100 ng pLS1755 were electrotransformed as in Example 1, and 100 ampicillin-resistant colonies were amplified and cultured.

[0067] Primers R511: 5'-GTAGAGCGTGCGGTGAAAGAG-3', (SEQ ID NO.13), R512: 5'-GGATACGTCCATGTAGTCAAC-3', (SEQ ID NO.14) were designed. Randomly pick 20 clones, use R511 and R512 as primers for colony PCR amplification, and get 557bp. The 557b product was p-sequenced with R511 as a primer, and two clones were found to have expected point mutations. Attached is the sequencing map of rpoB gene point mutation Figure 5 It shows that the 1691st base of the open reading frame is m...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for carrying out point mutations on essential genes on escherichia coli genomes by using the co-transformation of oligonucleotide and eliminable plasmids. Specifically, front four basic groups express recombinase in escherichia coli by using the co-transformation of oligonucleotide connected by sulfur phosphoryl, with a length of 91 basic groups, and having a mutation site in the middle, and eliminable plasmids. The eliminable plasmids contain homologous sequences of 50 bp lacZ genes, ampicillin resistance genes, I-SceI genes, two I-SceI cleavage sites and R6K replicators. In strains which are integrated with a 50 bp lacZ homologous fragment of a genome due to the catalysis of recombinase so as to express the amicillin resistance, the strains with point mutations are screened. Integrated strains can be induced to express I-SceI under the action of chlortetracycline subjected to heat inactivation, the I-SceI acts on cleavage sites thereof, and through the homologous recombination of two 50 bp lacZ fragments, the eliminable plasmids are eliminated.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a method for realizing the point mutation of Escherichia coli essential genes by cotransformation with oligonucleotides and eliminated plasmids. Background technique [0002] Escherichia coli is the most thoroughly studied microbial strain with important biological and industrial practical uses. Essential genes refer to a class of genes that are necessary for the survival of an organism. The point mutation of essential genes on the Escherichia coli genome is an important means to study gene functions, change the catalytic characteristics of enzymes expressed by genes, and construct new genetically engineered strains. [0003] The classic method of essential gene point mutation is to first construct a recombination clone containing a point mutation fragment, and both sides of the mutation site contain homologous fragments for homologous recombination. The vectors used are usua...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/70
Inventor尚广东骆希张青杨晨花月
Owner江苏沃纳生物科技有限公司