Unlock instant, AI-driven research and patent intelligence for your innovation.

miRNAs related to plant biomass and their related biomaterials and applications

A biomass and plant technology, applied in the field of miRNA and its related biomaterials, can solve the problem of high mutation rate in dealing with physical and chemical factors

Active Publication Date: 2016-03-23
INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] 3. Arabidopsis is a self-pollinated plant with a high degree of homozygosity in the gene. The mutation rate is high when treated with physical and chemical factors, and it is easy to obtain defective types of various metabolic functions.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • miRNAs related to plant biomass and their related biomaterials and applications
  • miRNAs related to plant biomass and their related biomaterials and applications
  • miRNAs related to plant biomass and their related biomaterials and applications

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] Embodiment 1, the construction of miR847 expression vector

[0063] Genomic DNA of Arabidopsis thaliana plants was extracted by CTAB method, and the following primers were used to use the genomic DNA as a template for PCR amplification: upstream primer (5'→3'):

[0064] ACAGATCTTGATCTGACGATGGAAG CATCAAGAAGATAAGGGGTGA CATGAGTTGAGCAGGGTA (underlined miR847 sequence) downstream primer (5'→3'):

[0065] CAG CATCAAGAAAGAAGAGGAGTGA GAAGAGTAAAAGCCATTA (reverse complement of miR847 is underlined). The PCR product was connected to the pGEM-T vector (purchased from TIANGEN Company) to obtain a recombinant vector. The above-mentioned upstream primer and pGEM-T vector general reverse primer M13RPCR were used to amplify and identify the recombinant vector inserted in the forward direction, and then sequenced. The sequencing results showed that the recombinant vector containing the DNA molecule shown in SEQIDNo.2 was named pGEMT-miR847. Among them, SEQ ID No.2 consists of 210 n...

Embodiment 2

[0066] Example 2, Acquisition of Arabidopsis / pCanG-35S-miR847

[0067] Using Arabidopsis thaliana as the recipient plant, pCanG-35S-miR847 was transformed into Arabidopsis thaliana, and the miR847-expressing plant Arabidopsis / pCanG-35S-miR847 was obtained. The specific method is as follows:

[0068] (1) Transformation of Arabidopsis

[0069] Columbia ecotype Arabidopsis thaliana seedlings were cultured in a 16hr light / 8hr dark environment for 4 weeks, and were ready for transformation when most of the plants bolted and flowered. Transfer the plasmid pCanG-35S-miR847 into the Agrobacterium tumefaciens strain EHA105, pick a single colony and culture it in 3ml LB medium containing kanamycin at 28°C with shaking at 250rpm overnight, then transfer the culture to 200ml LB for expansion culture . Until the Agrobacterium cultured to OD 600 When it reaches about 2.0, add acetosyringone (AS) to the bacterial solution so that the final concentration is 40 μM, and continue shaking cul...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a miRNA relevant to plant biomass, as well as related biological materials and applications thereof. The nucleotide sequence of the miRNA relevant to plant biomass is shown in SEQ ID No:1. The miRNA relevant to plant biomass and the related biological material can be used for regulating the biomass (such as single-plant leaf weight and / or single-plant leaf number and / or leaf area) of a target plant.

Description

technical field [0001] The present invention relates to miRNAs related to plant biomass and related biological materials and applications. Background technique [0002] Arabidopsis (Arabidopsisthaliana (L.) Heynh.), Brassicaceae (Brassicaceae) Arabidopsis (A.thaliana), also known as Arabidopsis, Arabidopsis, Arabidopsis. Arabidopsis has become a model plant for the study of genetics, cells, development, and molecular biology of flowering plants due to the following characteristics: [0003] 1. The advantages of Arabidopsis are small plants, short generation time (two months per generation), many seeds, and strong vitality. Second, the Arabidopsis genome is relatively small among flowering plants. The total length of each haploid genome (n=5) is only 70 million base pairs, which is only 1 / 80 of the length of the wheat genome. It is also the first plant genome to be sequenced. [0004] 3. Arabidopsis is a self-pollination plant with high gene homozygosity. The mutation rat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/84C12N1/21C12N5/10A01H5/00C12N15/113C12R1/01
Inventor 郭惠珊汪晶晶
Owner INST OF MICROBIOLOGY - CHINESE ACAD OF SCI