miRNAs related to plant biomass and their related biomaterials and applications
A biomass and plant technology, applied in the field of miRNA and its related biomaterials, can solve the problem of high mutation rate in dealing with physical and chemical factors
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0062] Embodiment 1, the construction of miR847 expression vector
[0063] Genomic DNA of Arabidopsis thaliana plants was extracted by CTAB method, and the following primers were used to use the genomic DNA as a template for PCR amplification: upstream primer (5'→3'):
[0064] ACAGATCTTGATCTGACGATGGAAG CATCAAGAAGATAAGGGGTGA CATGAGTTGAGCAGGGTA (underlined miR847 sequence) downstream primer (5'→3'):
[0065] CAG CATCAAGAAAGAAGAGGAGTGA GAAGAGTAAAAGCCATTA (reverse complement of miR847 is underlined). The PCR product was connected to the pGEM-T vector (purchased from TIANGEN Company) to obtain a recombinant vector. The above-mentioned upstream primer and pGEM-T vector general reverse primer M13RPCR were used to amplify and identify the recombinant vector inserted in the forward direction, and then sequenced. The sequencing results showed that the recombinant vector containing the DNA molecule shown in SEQIDNo.2 was named pGEMT-miR847. Among them, SEQ ID No.2 consists of 210 n...
Embodiment 2
[0066] Example 2, Acquisition of Arabidopsis / pCanG-35S-miR847
[0067] Using Arabidopsis thaliana as the recipient plant, pCanG-35S-miR847 was transformed into Arabidopsis thaliana, and the miR847-expressing plant Arabidopsis / pCanG-35S-miR847 was obtained. The specific method is as follows:
[0068] (1) Transformation of Arabidopsis
[0069] Columbia ecotype Arabidopsis thaliana seedlings were cultured in a 16hr light / 8hr dark environment for 4 weeks, and were ready for transformation when most of the plants bolted and flowered. Transfer the plasmid pCanG-35S-miR847 into the Agrobacterium tumefaciens strain EHA105, pick a single colony and culture it in 3ml LB medium containing kanamycin at 28°C with shaking at 250rpm overnight, then transfer the culture to 200ml LB for expansion culture . Until the Agrobacterium cultured to OD 600 When it reaches about 2.0, add acetosyringone (AS) to the bacterial solution so that the final concentration is 40 μM, and continue shaking cul...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 