A highly tropic bladder cancer-targeted tumor-killing adenovirus

A technology of adenovirus and bladder cancer, applied in the field of adenovirus for the treatment of bladder cancer, can solve the problems of lack of selective lysis of tumor cells, low replication ability of oncolytic adenovirus, difficulty in overcoming the immune system, etc., and achieve CAR receptor dependence Sexual problems, solving targeted problems, improving the effect of treatment

Inactive Publication Date: 2018-06-05
LANZHOU UNIVERSITY
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The following five obstacles in the prior art have affected the practical application of adenovirus vectors in the treatment of tumors: ① The CAR receptor (Coxsackie Adenovirus Receptor, CAR) dependence of adenovirus, and the entry of adenovirus into cells requires specificity on the cell surface The expression of the receptor CAR in tumor cells, especially in many malignant bladder tumors, the expression of CAR is missing, resulting in low transfection efficiency of adenovirus in tumor cells and poor oncolytic effect
② The targeting of adenovirus, because the adenovirus itself lacks the ability to selectively lyse tumor cells, the side effects are relatively large
③Oncolytic adenovirus has low replication ability, and the oncolytic effect of lysing tumors by replication is poor
④Security issues
⑤ Difficulty in administering the drug, the virus will be cleared by the body’s immune system after intravenous injection, and it is difficult to reach the effective amount of virus in the local tumor
However, it is difficult to overcome the immune system's ability to clear the virus, and it is difficult to achieve a sufficient therapeutic concentration, which makes it difficult to treat a considerable number of solid tumors.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A highly tropic bladder cancer-targeted tumor-killing adenovirus
  • A highly tropic bladder cancer-targeted tumor-killing adenovirus
  • A highly tropic bladder cancer-targeted tumor-killing adenovirus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0033] 1) Modification of the sequence of the ciliary region of adenovirus

[0034] Using the method of genetic engineering, the RGD sequence was integrated into the backbone plasmid of the adenovirus HI loop region to obtain pRGDAd. The fragment inserted into the RGD sequence was obtained by overlapping PCR (overlapping PCR) designed into the mutant sequence. Primers are as follows:

[0035] SEQ ID No 2 P1: 5’ CTGACTCTTAAGGACTAGTTTCGCGC 3’

[0036] SEQ ID No 3 P2: 5' GATCTCCACGAGTTGTGTCTCCTGT 3'

[0037] SEQ ID No 4 P3: 5'AACT CGTGGAGATCCAAGTGCATACTC 3'

[0038] SEQ ID No 5 P4: 5'ACGTAGGATCCATGCATGTTAATTAA 3' Using the pAdEasy-1 plasmid as a template and P1 and P2 as primers, bases 27241-30218 were cloned, and the 2979bp product upstream of the adenovirus HI loop was named RGD1.

[0039]

[0040] Using the pAdEasy-1 plasmid as a template, P3 and P4 as primers, clone 30219-33480, the 3283bp product downstream of the HI loop, named RGD2, and the PCR conditions were the s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention relates to high tropism bladder cancer targeting tumor-killing adenovirus, and discloses modified replication defective adenovirus for treating bladder cancer. According to the present invention, the RGD sequence is integrated into the adenovirus cilium zone to change the adenovirus tropism so as to improve the tropism on the bladder cancer lowly expressing the adenovirus receptor and solve the problem of low infection capability of the adenovirus vector on the bladder cancer lowly expressing the adenovirus receptor; in the tropism-modified adenovirus, the bladder epithelium-specific UPII promoter is adopted to control the expression of the suicide gene TK so as to construct the selectively expressing adenovirus; and the CAR receptor dependence problem of the adenovirus in the prior art and the targeting problem of the adenovirus in the prior art can be solved, and the treatment effect can be increased.

Description

technical field [0001] The present invention relates to a modified virus that can be used to treat tumors, specifically, the present invention relates to an adenovirus that can be used to treat bladder cancer. Background technique [0002] In my country, bladder cancer ranks first among urinary system tumors, causing serious losses in economic and social development, and the harm is very serious. Traditional radiotherapy and chemotherapy have disadvantages such as low anti-tumor ability, low killing index, and large side effects. The therapeutic effect is far from satisfactory. Therefore, it is very urgent to explore new treatment concepts, strategies and approaches to improve the therapeutic effect of bladder tumors. [0003] Adenovirus is an ideal carrier for tumor gene therapy and biotherapy. Adenoviral vector has become a commonly used gene therapy vector because of its advantages of easy preparation of high titer virus, ability to infect dividing and non-dividing cel...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/861C12N15/66A61P35/00
Inventor 王德贵田迎霞王志平牛海涛
Owner LANZHOU UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products