Elastin-like polypeptides (ELP) for prokaryotic expression of fusion protein Prx by non-digestion and non-chromatography purifying method

An elastin-like and fusion protein technology, applied in the field of genetic engineering, to achieve the effect of improving elastic function, simple operation and reducing impact

Active Publication Date: 2015-03-04
ZHENGZHOU UNIV
View PDF4 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, PrxI has become an important target for screening anti-tumor drugs. Therefore, prokaryotic expression of PrxI is of great significance for establishing a drug screening platform and screening anti-tumor drugs. At present, there is no non-enzymatic and non-chromatographic purification method for prokaryotic expression of Prx I related reports

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Elastin-like polypeptides (ELP) for prokaryotic expression of fusion protein Prx by non-digestion and non-chromatography purifying method
  • Elastin-like polypeptides (ELP) for prokaryotic expression of fusion protein Prx by non-digestion and non-chromatography purifying method
  • Elastin-like polypeptides (ELP) for prokaryotic expression of fusion protein Prx by non-digestion and non-chromatography purifying method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] combined with figure 1 Describe the method of preparation.

[0039] 1. Construction of promoter protein, precursor protein expression vector and host cell

[0040] (a) Synthesis of ELP-IN, ELP-IC and PrxI genes

[0041] The primers were synthesized by Shanghai Sangon Bioengineering Technology Service Co., Ltd., and the DNAs of ELP-IN and ELP-IC (SEQ ID NO: 1 and SEQ ID NO: 3) were obtained by PCR. The primer sequences are as follows:

[0042] ELP-IN:

[0043] 5' primer:

[0044] 5'GG CCATGG CCGTGCCTGGTAAAGGAGTTCC3' (Nco Ⅰ)

[0045] 3' primer:

[0046] 5'GCGC AAGCTT ATTCTTTCACATACAGGCACATGCC3'(HindⅢ)

[0047] ELP-IC:

[0048] 5' primer:

[0049] 5'CC CATATG GTGCCTGGTAAAGGAG3' (NdeI)

[0050] 3' primer:

[0051] 5'TTAAGGATCCGCTGTTATGGGTCAGAATATCGTT3'(BamH Ⅰ)

[0052] In addition, two primers were designed and synthesized for PCR cloning the cDNA of Prx Ⅰ. The primer sequences are as follows:

[0053] 5' primer:

[0054] 5'CG GGATCC ATGTCTTCAGGAAATG...

Embodiment 2

[0072] The groping of the indirect condition of embodiment 2 object protein

[0073] (a) Incubate for 4 hours under different temperature conditions

[0074] After the purified protein was incubated at different temperatures (4°C, 10°C, 15°C, 20°C, 25°C) for different durations (10min, 20min, 30min, 1h, 2h, 4h) at a ratio of 1:1, SDS- PAGE electrophoresis detection, drawing the relationship curve of self-cutting percentage and time under different temperature conditions ( Figure 7 ). Protein self-cleavage is relatively complete at 25°C. In order to reduce the impact of high temperature on the activity of the target protein, 25°C is temporarily used to induce self-cleavage.

[0075]

[0076] 1×Reaction buffer: (50mM Tris, 100mM NaCl, 5% Glycerol)

[0077] (b) 25°C water bath induces protein splicing

[0078] The promoter protein and the precursor protein were mixed at a ratio of 1:1, and the self-cleavage was induced for different periods of time (1min, 5min, 10min, 0.5...

Embodiment 3

[0079] Purification and activity detection of embodiment 3 target protein

[0080] (a) Purification of target protein

[0081] According to the system of Example 2, the purified protein was induced to self-cleavage of the precursor protein for 0.5 h at an optimum temperature of 25° C., and then purified by the ITC method to obtain the target protein PrxI ( Figure 9 ).

[0082] (b) Activity detection of PrxI

[0083] The activity of the PrxI prepared above was determined by referring to the PrxI activity detection method mentioned in the literature Adenanthin targets peroxiredoxin I and II to induce differentiation of leukemia cells. Detect the A340 value at different time points with BioTek Synergy2 multifunctional microplate reader (Molecular Devices, USA), draw the curve of A340 value changing with time ( Figure 10 ).

[0084] Results: The activity of the sample was comparable to that of the standard, and the whole purification process did not affect the activity of th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses elastin-like polypeptides (ELP) for prokaryotic expression of fusion protein Prx by a non-digestion and non-chromatography purifying method and belongs to the field of genetic engineering. According to the elastin-like polypeptides, the type of the fourth amino acid in an elastin-like pentapeptide unit is changed and the elasticity function of the fourth amino acid is improved, and therefore, the reduction of the ELP length becomes possible. The ratio of K, V and F in the fourth basic group in the ELP pentapeptide unit is enabled to be 1: 6: 3. In terms of inteins, the high-efficiency intein gp41-1 is adopted; the C-terminal and the N-terminal of the intein are expressed separately, and the internal gene of the intein is mutated. The elastin-like polypeptides (ELPs) are ELP-IN and precursor protein ELP-IC-PrxI. The protein Prx is purified in a non-chromatography way by use of the elasticity function of the elastin-like polypeptides; no chromatographic column is required for separation, and the target protein precipitates by virtue of incubation at a certain temperature; besides, the precipitate can be re-dissolved in a buffer solution, and consequently, the protein can be purified more efficiently and quickly.

Description

technical field [0001] The invention relates to an elastin-like polypeptide ELP, in particular to an elastin-like polypeptide ELP used for prokaryotic expression of a fusion protein Prx in a non-enzymatic and non-chromatographic purification method, and belongs to the field of genetic engineering. Background technique [0002] Non-enzymatic non-chromatographic purification technology is a method of separating and purifying fusion proteins by genetic engineering. Traditional protein purification relies on chromatographic purification. The equipment used in this method is expensive, which makes the protein production cost high; after purification, the target protein containing the fusion protein needs a tool enzyme (such as enterokinase) to remove the label. The enzyme has high production cost and poor specificity. . Intein-mediated self-cleavage makes it unnecessary to add tool enzymes, and the protein can be freed from the precursor protein after being induced under certain...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K19/00C07K14/00C12N15/63C12N1/21C12R1/19
Inventor刘宏民张贵星王西新章旭耀王龙珍王志茹袁君郑一超赵文郑甲信
OwnerZHENGZHOU UNIV