Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Tephrosia purpurea endophytic fungus TPL25 and application thereof in plant disease prevention and treatment

A technology of endophytic fungus and edamame, applied in the field of microorganisms, can solve the problems of agricultural product safety threats, chemical pesticide pollution, residual toxicity, etc.

Active Publication Date: 2015-04-22
HUNAN AGRICULTURAL UNIV +1
View PDF4 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Plant fungal diseases not only directly cause the decline in crop yield and quality, but also some pathogenic fungi can secrete and produce a variety of toxins and metabolites harmful to humans and animals during the process of infecting crops, posing a great threat to the safety of agricultural products
[0004]Chemical control is an effective way to control crop diseases, but chemical pesticides pollute the environment, induce bacteria to develop drug resistance, destroy ecological balance, and cause residual toxicity and other problems. , therefore, more and more attention has been paid to the research on the biological control of plant diseases

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tephrosia purpurea endophytic fungus TPL25 and application thereof in plant disease prevention and treatment
  • Tephrosia purpurea endophytic fungus TPL25 and application thereof in plant disease prevention and treatment
  • Tephrosia purpurea endophytic fungus TPL25 and application thereof in plant disease prevention and treatment

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Embodiment 1: Penicillium grisea ( Penicillium griseofulvum ) Separation and purification of TPL25

[0036] Penicillium grisea of ​​the present invention ( Penicillium griseofulvum ) TPL25 was obtained from gray edamame leaves on the campus of Hunan Agricultural University in Hunan Province, China. Isolation method: Disinfection of the tissue surface: Rinse the gray edamame leaves with sterile water, and cut them into small pieces of 0.5cm×0.5cm. Disinfect the surface of the above materials in an ultra-clean bench, the procedure is: rinsing with 75% alcohol by volume fraction for 3-5min→1g·L -1Rinse with mercury chloride for 30s-1min→5 times with sterile water. Separation and purification: Inoculate the sterilized tissue material on the poured PDA plate medium, 3-4 pieces per plate, and place it at 28±1°C for 3-7 days in the dark. When mycelia (colonies) grow out of the cuts along the outer edge of the material, the mycelium is picked by tip mycelium, and the myce...

Embodiment 2

[0037] Embodiment 2: Penicillium grisea ( Penicillium griseofulvum ) Identification of TPL25 strain

[0038] The strains were identified by combining morphological and molecular biological methods. Penicillium grisea TPL25 can grow on PDA medium, cultivated at a constant temperature of 28±1°C, the colony is light green at first, the edge is white, and later turns dark green, the texture is fluffy and granular, and conidia are produced in large quantities. Pale orange, soluble pigment similar to the lighter color on the reverse side (eg figure 1 ). Microscopic morphological features: conidia strung together, colorless, spherical (eg figure 2 ). The strain TPL25 was amplified by PCR using ITS sequence general primers ITS4 and ITS5 (ITS4: TCCTCCGCTTATTGATATGC; ITS5: GGAAGTAAAAGTCGTAACAAGG). Using TPL25 total DNA as a template, the PCR reaction conditions were: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 56°C for 30 s, extension at 72°C...

Embodiment 3

[0039] Embodiment 3: Penicillium grisea ( Penicillium griseofulvum ) Preliminary screening of TPL25 anti-pathogenic fungal activity.

[0040] Under sterile conditions, use the plate confrontation method for primary screening (such as Figure 4 ), the endophytic fungus strain TPL25 and the pathogenic fungus were respectively made into cakes with a 6mm hole punch, placed on 1 / 3 of the PDA plate, cultured at 28°C, and observed whether the endophytic strains and the tested pathogenic fungi had Antagonism, and measure the width of the inhibition zone, and compare the activity of each endophytic fungal strain.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses tephrosia purpurea endophytic fungus penicillium griseofulvum TPL25 and application of a fermentation product of the tephrosia purpurea endophytic fungus penicillium griseofulvum TPL25 in plant disease prevention fungal pathogens. The tephrosia purpurea endophytic fungus penicillium griseofulvum TPL25 is preserved in China Center for Type Culture Collection, and the preservation number is CCTCC NO: M2014607. Fungus fermentation liquor, fermentation liquor extractives and mycelium extractives have the strong mycelium grow inhibition function on sclerotinia rot of colza, tobacco blackleg and other phytopathogen, excellent strains are provided for development of microbial pesticide, and in addition, the tephrosia purpurea endophytic fungus is studied for the first time.

Description

technical field [0001] The invention belongs to the technical field of microorganisms, and relates to Penicillium grisea ( Penicillium griseofulvum ) TPL25 and its application in the control of plant diseases. Background technique [0002] gray edamame ( Tephrosia purpurea ) is a genus of edamame (Leguminosae) ( Tephrosia Pers .) Perennial woody plants, mainly distributed in tropical and subtropical regions, such as India, Pakistan, Vietnam, Cambodia, Laos, Myanmar, and Guangdong, Guangxi, Yunnan, Fujian and Hunan in China. The branches and leaves of gray edamame can be used as green manure, smashed and thrown into the water to poison fish, and it is also a good sand-fixing and embankment soil-conserving plant. At present, the research on edamame mainly focuses on phytochemistry and pharmacology, and there are few reports on endophytic fungi. [0003] Plant diseases have always been one of the important factors restricting high-quality and high-yield crops, and among p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/14A01N63/04A01P3/00C12R1/80
CPCA01N63/30C12N1/145C12R2001/80
Inventor 李有志罗仄平丁文兵邹凯
Owner HUNAN AGRICULTURAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com