Supercharge Your Innovation With Domain-Expert AI Agents!

Endophytic fungus tpl25 of edamame and its application in the control of plant diseases

A technology of endophytic fungi and edamame, applied in the field of microorganisms, can solve problems such as threats to the safety of agricultural products, destruction of ecological balance, and decline in crop yields.

Active Publication Date: 2017-09-05
HUNAN AGRICULTURAL UNIV +1
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Plant fungal diseases not only directly cause the decline in crop yield and quality, but also some pathogenic fungi can secrete and produce a variety of toxins and metabolites harmful to humans and animals during the process of infecting crops, posing a great threat to the safety of agricultural products
[0004]Chemical control is an effective way to control crop diseases, but chemical pesticides pollute the environment, induce bacteria to develop drug resistance, destroy ecological balance, and cause residual toxicity and other problems. , therefore, more and more attention has been paid to the research on the biological control of plant diseases

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Endophytic fungus tpl25 of edamame and its application in the control of plant diseases
  • Endophytic fungus tpl25 of edamame and its application in the control of plant diseases
  • Endophytic fungus tpl25 of edamame and its application in the control of plant diseases

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1: Isolation and purification of Penicillium griseofulvum TPL25

[0036]The Penicillium griseofulvum (Penicillium griseofulvum) TPL25 of the present invention comes from the leaves of edamame on the campus of Hunan Agricultural University in Hunan Province, China. Isolation method: Disinfection of the tissue surface: Rinse the gray edamame leaves with sterile water, and cut them into small pieces of 0.5cm×0.5cm. Disinfect the surface of the above materials in an ultra-clean bench, the procedure is: rinsing with 75% alcohol by volume fraction for 3-5min→1g·L -1 Rinse with mercury chloride for 30s-1min→5 times with sterile water. Separation and purification: Inoculate the sterilized tissue material on the poured PDA plate medium, 3-4 pieces per plate, and place it at 28±1°C for 3-7 days in the dark. When mycelia (colonies) grow out of the cuts along the outer edge of the material, the mycelium is picked by tip mycelium, and the mycelium is transferred to the pur...

Embodiment 2

[0037] Example 2: Identification of Penicillium griseofulvum (Penicillium griseofulvum) TPL25 strain

[0038] The strains were identified by combining morphological and molecular biological methods. Penicillium grisea TPL25 can grow on PDA medium, cultivated at a constant temperature of 28±1°C, the colony is light green at first, the edge is white, and later turns dark green, the texture is fluffy and granular, and conidia are produced in large quantities. Pale orange, soluble pigment similar to the lighter color on the reverse side (eg figure 1 ). Microscopic morphological features: conidia strung together, colorless, spherical (eg figure 2 ). The strain TPL25 was amplified by PCR using ITS sequence general primers ITS4 and ITS5 (ITS4: TCCTCCGCTTATTGATATGC; ITS5: GGAAGTAAAAGTCGTAACAAGG). Using TPL25 total DNA as a template, the PCR reaction conditions were: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 56°C for 30 s, extension at 72°C fo...

Embodiment 3

[0039] Example 3: Preliminary screening of anti-pathogenic fungal activity of Penicillium griseofulvum TPL25.

[0040] Under sterile conditions, use the plate confrontation method for primary screening (such as Figure 4 ), the endophytic fungus strain TPL25 and the pathogenic fungus were respectively made into cakes with a 6mm hole punch, placed on 1 / 3 of the PDA plate, cultured at 28°C, and observed whether the endophytic strains and the tested pathogenic fungi had Antagonism, and measure the width of the inhibition zone, and compare the activity of each endophytic fungal strain.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a Tephrosia purpurea endophytic fungus Penicillium griseofulvum (Penicillium griseofulvum) TPL25, which is preserved in the China Center for Type Culture Collection, preservation number CCTCC NO: M 2014607, and its fermentation product is effective in resisting plant Application in pathogenic fungi. The bacterium fermented liquid of the present invention and fermented liquid extract and mycelia extract have stronger mycelial growth inhibitory action to plant pathogenic bacteria such as rape sclerotinia, tobacco black shank, etc., provide excellent for the development of microbial source pesticide Bacterial strains, in addition, the present invention is the first research on the endophytic fungus of edamame.

Description

technical field [0001] The invention belongs to the technical field of microbes, and relates to Penicillium griseofulvum TPL25 and its application in preventing and treating plant diseases. Background technique [0002] Tephrosia purpurea is a perennial woody plant of the Leguminosae genus TephrosiaPers. It is mainly distributed in tropical and subtropical regions, such as India, Pakistan, Vietnam, Cambodia, Laos, Myanmar and Guangdong, China. Guangxi, Yunnan, Fujian and Hunan and other places. The branches and leaves of gray edamame can be used as green manure, smashed and thrown into the water to poison fish, and it is also a good sand-fixing and embankment soil-conserving plant. At present, the research on edamame mainly focuses on phytochemistry and pharmacology, and there are few reports on endophytic fungi. [0003] Plant diseases have always been one of the important factors restricting the high-quality and high-yield of crops, and among plant diseases, 70%-80% of d...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/14A01N63/04A01P3/00C12R1/80
CPCA01N63/30C12N1/145C12R2001/80
Inventor 李有志罗仄平丁文兵邹凯
Owner HUNAN AGRICULTURAL UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More