Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Endophytic fungus tpl35 of edamame and its application in the control of plant diseases

A technology of endophytic fungi and edamame, applied in the field of microorganisms, can solve problems such as threats to the safety of agricultural products, destruction of ecological balance, and decline in crop yields.

Active Publication Date: 2017-12-12
湖南农杰科技发展有限公司
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Plant fungal diseases not only directly cause the decline in crop yield and quality, but also some pathogenic fungi can secrete and produce a variety of toxins and metabolites harmful to humans and animals during the process of infecting crops, posing a great threat to the safety of agricultural products
[0004]Chemical control is an effective way to control crop diseases, but chemical pesticides pollute the environment, induce bacteria to develop drug resistance, destroy ecological balance, and cause residual toxicity and other problems. , therefore, more and more attention has been paid to the research on the biological control of plant diseases

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Endophytic fungus tpl35 of edamame and its application in the control of plant diseases
  • Endophytic fungus tpl35 of edamame and its application in the control of plant diseases
  • Endophytic fungus tpl35 of edamame and its application in the control of plant diseases

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Embodiment 1: Aspergillus oryzae ( Aspergillus oryzae ) Isolation and purification of TPL35

[0035] Aspergillus oryzae ( Aspergillus oryzae ) TPL35 was obtained from edamame leaves on the campus of Hunan Agricultural University in Hunan Province, China. Separation method: Disinfect the surface of the tissue: Rinse the gray edamame leaves with sterile water, and cut them into small pieces of 0.5cm×0.5cm. Disinfect the surface of the above materials in an ultra-clean bench, the procedure is: rinsing with 75% alcohol by volume fraction for 3-5min→1g·L -1 Rinse with mercury chloride for 30s-1min→5 times with sterile water. Isolation: Inoculate the sterilized tissue material on the poured PDA plate culture medium, 3-4 pieces per dish, and place it at 28±1°C in the dark for 3-7 days. When hyphae (colonies) grow out of the cuts along the outer edge of the material, the mycelium is transferred to the purified PDA medium plate by using the tip mycelia picking method until a...

Embodiment 2

[0036] Embodiment 2: Aspergillus oryzae ( Aspergillus oryzae ) Identification of TPL35 strain

[0037]The strains were identified by combining morphological and molecular biological methods. Aspergillus oryzae TPL35 can grow on PDA medium, cultivated at a constant temperature of 28±1°C, the colony is initially white, and later becomes light yellow or white, and densely grows small granular spore clusters (such as figure 1 ). Microscopic morphological features: conidia are colorless and oval (such as figure 2 ). The strain TPL35 was amplified by PCR using ITS sequence general primers ITS4 and ITS5 (ITS4: TCCTCCGCTTATTGATATGC; ITS5: GGAAGTAAAAGTCGTAACAAGG). Using TPL35 total DNA as a template, the PCR reaction conditions were: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 45 s, and 30 cycles; extension at 72°C for 10 min; storage at 4°C. The amplified gene sequence was sent to the biological company fo...

Embodiment 3

[0038] Embodiment 3: Aspergillus oryzae ( Aspergillus oryzae ) Preliminary screening of anti-pathogenic fungal activity of TPL35.

[0039] Under sterile conditions, use the plate confrontation method for primary screening (such as Figure 4 ), the endophytic fungus strain TPL35 and the pathogenic fungus were respectively made into cakes with a 6mm puncher, placed on 1 / 3 of the PDA plate, cultured at 28°C, and observed whether the endophytic strains and the tested pathogenic fungi had Antagonism, and measure the width of the inhibition zone, and compare the activity of each endophytic fungal strain.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gray soybean (Tephrosia purpurea) endophyte Aspergillus oryzae (Aspergillus oryzae) TPL35, which is preserved in the China Center for Type Culture Collection, preservation number CCTCC NO: M 2014608, and its fermentation product is effective in resisting plant pathogenic fungi in the application. The bacterial fermentation broth, fermentation broth extract and mycelium extract of the present invention have strong mycelial growth inhibitory effect on rape sclerotinia, tobacco black shank and other plant pathogenic bacteria, and provide excellent strains for the development of microbial source pesticides , In addition, the present invention is the first research on the endophytic fungus of edamame.

Description

technical field [0001] The invention belongs to the technical field of microorganisms, and relates to a kind of Aspergillus oryzae ( Aspergillus oryzae ) TPL35 and its application in the control of plant diseases. Background technique [0002] gray edamame ( Tephrosia purpurea ) is a genus of edamame (Leguminosae) ( Tephrosia Pers .) Perennial woody plants, mainly distributed in tropical and subtropical regions, such as India, Pakistan, Vietnam, Cambodia, Laos, Myanmar, and Guangdong, Guangxi, Yunnan, Fujian and Hunan in China. The branches and leaves of gray edamame can be used as green manure, smashed and thrown into the water to poison fish, and it is also a good sand-fixing and embankment soil-conserving plant. At present, the research on edamame mainly focuses on phytochemistry and pharmacology, and there are few reports on endophytic fungi. [0003] Plant diseases have always been one of the important factors restricting the high-quality and high-yield of crops...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/14A01N63/04A01P3/00C12R1/69
CPCA01N63/30C12N1/145C12R2001/69
Inventor 李有志罗仄平丁文兵
Owner 湖南农杰科技发展有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com