Endophytic fungus tpl35 of edamame and its application in the control of plant diseases
A technology of endophytic fungi and edamame, applied in the field of microorganisms, can solve problems such as threats to the safety of agricultural products, destruction of ecological balance, and decline in crop yields.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Embodiment 1: Aspergillus oryzae ( Aspergillus oryzae ) Isolation and purification of TPL35
[0035] Aspergillus oryzae ( Aspergillus oryzae ) TPL35 was obtained from edamame leaves on the campus of Hunan Agricultural University in Hunan Province, China. Separation method: Disinfect the surface of the tissue: Rinse the gray edamame leaves with sterile water, and cut them into small pieces of 0.5cm×0.5cm. Disinfect the surface of the above materials in an ultra-clean bench, the procedure is: rinsing with 75% alcohol by volume fraction for 3-5min→1g·L -1 Rinse with mercury chloride for 30s-1min→5 times with sterile water. Isolation: Inoculate the sterilized tissue material on the poured PDA plate culture medium, 3-4 pieces per dish, and place it at 28±1°C in the dark for 3-7 days. When hyphae (colonies) grow out of the cuts along the outer edge of the material, the mycelium is transferred to the purified PDA medium plate by using the tip mycelia picking method until a...
Embodiment 2
[0036] Embodiment 2: Aspergillus oryzae ( Aspergillus oryzae ) Identification of TPL35 strain
[0037]The strains were identified by combining morphological and molecular biological methods. Aspergillus oryzae TPL35 can grow on PDA medium, cultivated at a constant temperature of 28±1°C, the colony is initially white, and later becomes light yellow or white, and densely grows small granular spore clusters (such as figure 1 ). Microscopic morphological features: conidia are colorless and oval (such as figure 2 ). The strain TPL35 was amplified by PCR using ITS sequence general primers ITS4 and ITS5 (ITS4: TCCTCCGCTTATTGATATGC; ITS5: GGAAGTAAAAGTCGTAACAAGG). Using TPL35 total DNA as a template, the PCR reaction conditions were: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 45 s, and 30 cycles; extension at 72°C for 10 min; storage at 4°C. The amplified gene sequence was sent to the biological company fo...
Embodiment 3
[0038] Embodiment 3: Aspergillus oryzae ( Aspergillus oryzae ) Preliminary screening of anti-pathogenic fungal activity of TPL35.
[0039] Under sterile conditions, use the plate confrontation method for primary screening (such as Figure 4 ), the endophytic fungus strain TPL35 and the pathogenic fungus were respectively made into cakes with a 6mm puncher, placed on 1 / 3 of the PDA plate, cultured at 28°C, and observed whether the endophytic strains and the tested pathogenic fungi had Antagonism, and measure the width of the inhibition zone, and compare the activity of each endophytic fungal strain.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


