Method of establishing hepatic fibrosis animal fertilized eggs based on micro RNA interference
An RNA interference, liver fibrosis technology, applied in DNA/RNA fragments, recombinant DNA technology, introduction of foreign genetic material using vectors, etc., can solve the problems that miRNA cannot be well reflected, the action time is short, and the cost is high.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0020] The present invention will be further described through experiments and examples below. It should be understood that these examples are for illustrative purposes only and by no means limit the scope of protection of the present invention.
[0021] The specific technical scheme of the present invention is:
[0022] 1. Construction of CAGG-sponges-miR-483 plasmid
[0023] Select the mouse miR-483 sequence (NC_000073.6: aagacgggagaagagaagggag) on NCBI, design its antisense sequence, first design the antisense sequence of miR-483 sequence, and then add the "CTTC" connecting sequence between the two antisense sequences, Finally, it constitutes six copies of the antisense sequence. The nucleotide sequence of the six copies of the antisense sequence is SEQ ID No. 1. The six copies of the antisense sequence are synthesized, and the two ends of the antisense sequence are introduced into the restriction site of EcoR I , EcoR I separately digested six copies of miR-483 antisense seque...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com