Unlock instant, AI-driven research and patent intelligence for your innovation.

Method of establishing hepatic fibrosis animal fertilized eggs based on micro RNA interference

An RNA interference, liver fibrosis technology, applied in DNA/RNA fragments, recombinant DNA technology, introduction of foreign genetic material using vectors, etc., can solve the problems that miRNA cannot be well reflected, the action time is short, and the cost is high.

Inactive Publication Date: 2015-07-08
HARBIN MEDICAL UNIVERSITY
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these have obvious disadvantages: injection of specific miRNA mimics or inhibitors will increase transient expression, which cannot well reflect the effect of miRNA on the disease; the cost is high, repeated transfection or injection is required, and all belong to in vitro experiments , cannot well reflect the real action in the body
Among them, the more prominent ones are the short duration of action and the inability to be passed down.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method of establishing hepatic fibrosis animal fertilized eggs based on micro RNA interference
  • Method of establishing hepatic fibrosis animal fertilized eggs based on micro RNA interference
  • Method of establishing hepatic fibrosis animal fertilized eggs based on micro RNA interference

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0020] The present invention will be further described through experiments and examples below. It should be understood that these examples are for illustrative purposes only and by no means limit the scope of protection of the present invention.

[0021] The specific technical scheme of the present invention is:

[0022] 1. Construction of CAGG-sponges-miR-483 plasmid

[0023] Select the mouse miR-483 sequence (NC_000073.6: aagacgggagaagagaagggag) on ​​NCBI, design its antisense sequence, first design the antisense sequence of miR-483 sequence, and then add the "CTTC" connecting sequence between the two antisense sequences, Finally, it constitutes six copies of the antisense sequence. The nucleotide sequence of the six copies of the antisense sequence is SEQ ID No. 1. The six copies of the antisense sequence are synthesized, and the two ends of the antisense sequence are introduced into the restriction site of EcoR I , EcoR I separately digested six copies of miR-483 antisense seque...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method of establishing hepatic fibrosis animal fertilized eggs based on micro RNA interference and belong to the technical field of biology. In the invention, firstly a CAGG-Sponges-miR-483 plasmid is constructed and then fertilized eggs of transgenic mice with stable interference of miR-483 are established. In the invention, a genetic alteration mouse model based on micro RNA stable interference is established, wherein the model is achieved on the basis of integrating an exogenous nucleotide sequence into the genome of mouse. The method can be used as an in-vivo model for researching the mechanism of hepatic fibrosis, and provides a reliable platform for the researching of in-vivo functions of micro RNA in hepatic fibrosis.

Description

Technical field [0001] The invention specifically relates to a method for establishing fertilized eggs of liver fibrosis animals based on microRNA interference, and belongs to the field of biotechnology. Background technique [0002] Patients with hepatic fibrosis often develop liver failure and portal hypertension in the late stage, manifesting as serious complications such as hepatic encephalopathy, rupture of esophageal and gastric fundus veins, and peritonitis, which can even evolve into cirrhosis and liver cancer, endangering the lives of patients. Early prevention and reversal of liver fibrosis has become a research hotspot. Experimental animal models are important conditions for the study of liver fibrosis mechanisms and the evaluation of new drugs. For animal models of liver fibrosis, currently there are mainly chemical methods (carbon tetrachloride, etc.) and alcohol induction. [0003] The vast majority of human diseases stem from abnormal gene expression. In recent yea...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85C12N15/113C12N5/10
Inventor 高旭刘彦虹张艳芬马宁董敏乔瑜王曦迪徐亚娄阁
Owner HARBIN MEDICAL UNIVERSITY