Method for aided detection of heterodera glycines resistance and special primers for detection of heterodera glycines resistance
A soybean cyst nematode, resistance technology, applied in the direction of biochemical equipment and methods, microbial measurement/inspection, DNA/RNA fragments, etc., can solve the problems of difficult success, long time, etc., achieve high accuracy, improve selection High efficiency and high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Embodiment 1, the design of primer
[0030] Download the GmSHMT gene sequence (GenBank accession number: JQ714083, from disease-resistant germplasm Forrest) from GenBank (http: / / www.ncbi.nlm.nih.gov / nuccore / JQ714083), and use the Primer5.0 software to design PCR primers: Primers Pair 1; The PCR product of primer pair 1 is expected to be 369bp in length, and two fragments of 237bp and 132bp can be theoretically obtained after digestion with BsrBI enzyme.
[0031] Primer pair 1:
[0032] F: CCTCCAAGCCTTTCCACCTCG (sequence 1);
[0033] R: CCGCACTTATCAGCGACTTCC (sequence 2).
Embodiment 2
[0034] Example 2, the application of primers in the detection of soybean cyst nematode resistance
[0035] 1. Genomic DNA extraction
[0036] 9 known genotypes (Peking, PI90763, Forrest, PI437654, PI209332, PI548316 (Cloud), PI88788, Essex, Williams) and 4 unknown genotypes (Yuanbo black beans, Chibuliu black beans, Kangxian 1 and Taixing black soybean) a total of 13 samples of soybean genomic DNA to be tested.
[0037] 2. PCR amplification
[0038] Taking each soybean genomic DNA to be tested as a template, carry out PCR amplification with the primer pair 1 of Example 1 respectively, to obtain PCR amplification products;
[0039] 20 μL of the above PCR amplification reaction system (PCR reagents containing primer pairs), including 10 ng μL -1 Genomic DNA 5 μL, 10×PCR buffer (Quanshijin Biotechnology Co., Ltd.) 2 μL, 2.5 mmolL -1 dNTPs1.5μL, 2μmolL -1 1.5 μL of each primer and 0.2 μL of 1U Taq polymerase, 8.7 μL of sterile water and water.
[0040] The above reaction pro...
Embodiment 3
[0070] Example 3, the application of primers in the detection of soybean cyst nematode resistance
[0071] The varieties in Table 1 were tested respectively by using the primer pair 1 of Step 1-3 of Example 2, and the enzyme digestion results are shown in Table 1.
[0072] The varieties in Table 1 were tested respectively by Step 4 of Example 2, and the resistance results are shown in Table 1.
[0073] The result further shows that the soybean cyst nematode resistance can be detected by using the primer pair 1 and the method of the present invention, and the identification is accurate.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
