Method for aided detection of heterodera glycines resistance and special primers for detection of heterodera glycines resistance

A soybean cyst nematode, resistance technology, applied in the direction of biochemical equipment and methods, microbial measurement/inspection, DNA/RNA fragments, etc., can solve the problems of difficult success, long time, etc., achieve high accuracy, improve selection High efficiency and high sensitivity

Inactive Publication Date: 2015-07-15
INST OF CROP SCI CHINESE ACAD OF AGRI SCI
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the genetic complexity of SCN resistance genes and the diversity of soybean cyst nematode races (Riggs and Schmidt 1988; Caviness 1992), it takes a long time to develop varieties resistant to soybean cyst nematode dise

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for aided detection of heterodera glycines resistance and special primers for detection of heterodera glycines resistance
  • Method for aided detection of heterodera glycines resistance and special primers for detection of heterodera glycines resistance
  • Method for aided detection of heterodera glycines resistance and special primers for detection of heterodera glycines resistance

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Embodiment 1, the design of primer

[0030] Download the GmSHMT gene sequence (GenBank accession number: JQ714083, from disease-resistant germplasm Forrest) from GenBank (http: / / www.ncbi.nlm.nih.gov / nuccore / JQ714083), and use the Primer5.0 software to design PCR primers: Primers Pair 1; The PCR product of primer pair 1 is expected to be 369bp in length, and two fragments of 237bp and 132bp can be theoretically obtained after digestion with BsrBI enzyme.

[0031] Primer pair 1:

[0032] F: CCTCCAAGCCTTTCCACCTCG (sequence 1);

[0033] R: CCGCACTTATCAGCGACTTCC (sequence 2).

Embodiment 2

[0034] Example 2, the application of primers in the detection of soybean cyst nematode resistance

[0035] 1. Genomic DNA extraction

[0036] 9 known genotypes (Peking, PI90763, Forrest, PI437654, PI209332, PI548316 (Cloud), PI88788, Essex, Williams) and 4 unknown genotypes (Yuanbo black beans, Chibuliu black beans, Kangxian 1 and Taixing black soybean) a total of 13 samples of soybean genomic DNA to be tested.

[0037] 2. PCR amplification

[0038] Taking each soybean genomic DNA to be tested as a template, carry out PCR amplification with the primer pair 1 of Example 1 respectively, to obtain PCR amplification products;

[0039] 20 μL of the above PCR amplification reaction system (PCR reagents containing primer pairs), including 10 ng μL -1 Genomic DNA 5 μL, 10×PCR buffer (Quanshijin Biotechnology Co., Ltd.) 2 μL, 2.5 mmolL -1 dNTPs1.5μL, 2μmolL -1 1.5 μL of each primer and 0.2 μL of 1U Taq polymerase, 8.7 μL of sterile water and water.

[0040] The above reaction pro...

Embodiment 3

[0070] Example 3, the application of primers in the detection of soybean cyst nematode resistance

[0071] The varieties in Table 1 were tested respectively by using the primer pair 1 of Step 1-3 of Example 2, and the enzyme digestion results are shown in Table 1.

[0072] The varieties in Table 1 were tested respectively by Step 4 of Example 2, and the resistance results are shown in Table 1.

[0073] The result further shows that the soybean cyst nematode resistance can be detected by using the primer pair 1 and the method of the present invention, and the identification is accurate.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a method for aided detection of heterodera glycines resistance and special primers for detection of heterodera glycines resistance. A primer pair for detecting the resistance of the heterodera glycines to be tested is provided and is composed of a single-stranded DNA molecule shown in sequence 1 in a sequence table and a single-stranded DNA shown in sequence 2 in the sequence table. The experiment provided by the invention shows that the primers designed by the invention can be used for specifically identifying the race 3 physiological race soybean of the heterodera glycines with high sensitivity and high accuracy, the selecting efficiency of the material in the breeding process can be greatly increased and the breeding material can be screened.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a method for assisting detection of soybean cyst nematode resistance and special primers. Background technique [0002] Soybean cyst nematode (soybean cyst nematode, SCN) is an important disease that endangers the production of soybean (Glycine max L.Merr) in the world. Cost-effective measures against soybean cyst nematode disease. Due to the genetic complexity of SCN resistance genes and the diversity of soybean cyst nematode races (Riggs and Schmidt 1988; Caviness 1992), it takes a long time to develop varieties resistant to soybean cyst nematode disease by traditional breeding methods. Time, and difficult to succeed, can not meet the current development of line-resistant breeding, an urgent need for a more accurate and efficient method of identifying SCN. With the development and use of molecular markers, molecular marker-assisted selection (Molecular marker-assisted selection, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6895
Inventor 邱丽娟李英慧史学晖
Owner INST OF CROP SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap