Heat-resisting beta-glucosidase and application of heat-resisting beta-glucosidase mutants to arctigenin preparation
A technology of glucosidase and arctigenin, applied in the direction of glycosylase, enzyme, hydrolase, etc., can solve the problems of low substrate specificity, long conversion time and high cost of enzyme action, and achieve product separation and Ease of purification, short conversion time, and less reaction by-products
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0017] According to the beta-glucosidase gene sequence design of the family 1 of Thermotoga (Thermotiga), the mutation primers are specifically:
[0018] N223T-N: AGTTTTCAATACCGGATATTTCGAACCTGCGAGT (SEQ ID NO.4) and N223T-C: ATTCCGATCTTTCCATCTTTCACG (SEQ ID NO.5); Select the recombinant plasmid pET-20b-bglA (J Ind Microbiol Biotechnol, 2009,36:1401-1408) was used as template to carry out reverse PCR amplification to obtain the nucleotide fragment containing β-glucosidase mutant gene, by phosphorylation, ligation, transformation, and extracting the plasmid, to obtain the nucleotide fragment containing The recombinant plasmid of the N223T nucleotide fragment is further transformed into a host to express it, and thus the β-glucosidase mutant N223T of the present invention is obtained.
Embodiment 2
[0020] Basically the same as Example 1, the difference is that the primers used are respectively: the upstream primer is G224F-N:5'-AGTTTTCAACAACTTCTATTTCGAACCTGCGAGT-3' (SEQ ID NO.6) and the downstream primer is G224F-C:5'-ATTCCGATCTTTCCATCTTTCACG- 3' (SEQ ID NO.7); to obtain a recombinant plasmid containing the G224F nucleotide fragment, and further transform the host to express it, that is, to obtain the β-glucosidase mutant G224F of the present invention.
Embodiment 3
[0022]It is basically the same as Example 1, except that the primers used are: N223T / G224F-N: AGTTTTCAATACCTTTCTATTTCGAACCTGCGAGT (SEQ ID NO.8), the downstream primer is N223T / G224F-C: ATTCCGATCTTTCCATCTTTCACG (SEQ ID NO.9), and A recombinant plasmid containing the N223T / G224F nucleotide fragment is obtained, and the host is further transformed to express it, thereby obtaining the β-glucosidase mutant N223T / G224F of the present invention.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 