Unlock instant, AI-driven research and patent intelligence for your innovation.

Heat-resisting beta-glucosidase and application of heat-resisting beta-glucosidase mutants to arctigenin preparation

A technology of glucosidase and arctigenin, applied in the direction of glycosylase, enzyme, hydrolase, etc., can solve the problems of low substrate specificity, long conversion time and high cost of enzyme action, and achieve product separation and Ease of purification, short conversion time, and less reaction by-products

Inactive Publication Date: 2015-08-05
NANJING NORMAL UNIVERSITY
View PDF7 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although many related papers have been published and patent applications have been published, the problems of long conversion time, low substrate specificity, low yield and high cost have not been solved well.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Heat-resisting beta-glucosidase and application of heat-resisting beta-glucosidase mutants to arctigenin preparation
  • Heat-resisting beta-glucosidase and application of heat-resisting beta-glucosidase mutants to arctigenin preparation
  • Heat-resisting beta-glucosidase and application of heat-resisting beta-glucosidase mutants to arctigenin preparation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] According to the beta-glucosidase gene sequence design of the family 1 of Thermotoga (Thermotiga), the mutation primers are specifically:

[0018] N223T-N: AGTTTTCAATACCGGATATTTCGAACCTGCGAGT (SEQ ID NO.4) and N223T-C: ATTCCGATCTTTCCATCTTTCACG (SEQ ID NO.5); Select the recombinant plasmid pET-20b-bglA (J Ind Microbiol Biotechnol, 2009,36:1401-1408) was used as template to carry out reverse PCR amplification to obtain the nucleotide fragment containing β-glucosidase mutant gene, by phosphorylation, ligation, transformation, and extracting the plasmid, to obtain the nucleotide fragment containing The recombinant plasmid of the N223T nucleotide fragment is further transformed into a host to express it, and thus the β-glucosidase mutant N223T of the present invention is obtained.

Embodiment 2

[0020] Basically the same as Example 1, the difference is that the primers used are respectively: the upstream primer is G224F-N:5'-AGTTTTCAACAACTTCTATTTCGAACCTGCGAGT-3' (SEQ ID NO.6) and the downstream primer is G224F-C:5'-ATTCCGATCTTTCCATCTTTCACG- 3' (SEQ ID NO.7); to obtain a recombinant plasmid containing the G224F nucleotide fragment, and further transform the host to express it, that is, to obtain the β-glucosidase mutant G224F of the present invention.

Embodiment 3

[0022]It is basically the same as Example 1, except that the primers used are: N223T / G224F-N: AGTTTTCAATACCTTTCTATTTCGAACCTGCGAGT (SEQ ID NO.8), the downstream primer is N223T / G224F-C: ATTCCGATCTTTCCATCTTTCACG (SEQ ID NO.9), and A recombinant plasmid containing the N223T / G224F nucleotide fragment is obtained, and the host is further transformed to express it, thereby obtaining the β-glucosidase mutant N223T / G224F of the present invention.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of heat-resisting beta-glucosidase mutants N223T, G224F and N223T / G224F to transforming arctiin into arctigenin. Amino acid sequences of the heat-resisting beta-glucosidase mutants N223T, G224F and N223T / G224F are indicated in SEQ: ID NO.1, ID NO.2 and ID NO.3. The arctiin is hydrolyzed to prepare the arctigenin by the aid of heat-resisting beta-glucosidase and the mutants thereof, and as compared with wild-type enzyme, the heat-resisting beta-glucosidase has the advantages of high transformation efficiency, fewer reaction by-products, high yield and purity, easiness in separation and purification, less chemical pollution and the like.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a heat-resistant beta-glucosidase mutant N223T, G224F and N223T / G224F, and the application of the enzyme and the mutant in converting arctiin into arctigenin. technical background [0002] Arctigenin is a kind of Chinese herbal medicine, which has the effects of treating or preventing chronic renal failure and renal fibrosis, anti-virus, anti-tumor, etc. 4-5 times the content of aglycone. Studies have found that arctiin in the form of glycosides does not have the best physiological activity state, and must be converted into arctigenin in the form of aglycone under the action of β-glucosidase before it can be absorbed and exert its medicinal effect. Therefore, if arctiin is converted into arctigenin, the production yield of arctigenin will be greatly improved, its bioavailability will be improved, and the cost will be reduced. At present, the methods for preparing arctigenin mainly ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/42C12P17/04
CPCC12N9/2445C12P17/04C12Y302/01021
Inventor 薛业敏候静静
Owner NANJING NORMAL UNIVERSITY