Primer and kit for detecting CYP2C9 and VKORC1 gene polymorphism and PCR method of primer and kit
A gene polymorphism and kit technology, applied in biochemical equipment and methods, microbial measurement/testing, DNA/RNA fragments, etc., can solve the problem of inability to detect clinical specimens on a large scale at the same time, high price of testing instruments, and clinical popularization Low degree of problems, to avoid site mismatch, fast detection speed, good sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0128] Example 1: Preparation of wild type and mutant positive plasmids for detection of CYP2C9 gene rs1057910 polymorphism
[0129] First, we call out the gene sequence before and after the rs1057910 polymorphic site of the CYP2C9 gene from the gene bank, and mark the polymorphic site with a double underline, at the appropriate position upstream and downstream of the rs1057910 site of the CYP2C9 gene (in bold and underlined marked), design a pair of cloning primers, the amplified fragment is 269bp, including the mutation site, the gene sequence is shown below, SEQ No.1:
[0130] catgattcatatacccctgaattgctacaacaaatgtgccatttttctccttttccatcagtttttacttgtgtcttatcagctaaagtcca ggaagagattgaacgtgtgattg gcagaaaccggagcccctgcatgcaagacaggagccacatgccctacacagatgctgtggtgcacgaggtccagagatac a ttgaccttctccccaccagcctgccccatgcagtgacctgtgacattaaattcagaaactatctcattcccaaggtaagtttgtttctcctacactgcaactccatgttttcgaagtccccaaattcatagtatcatttttaa acctctaccatcaccgggtgag agaagtgcataactcatatgtatggca...
Embodiment 2
[0146] Example 2: Design and specificity screening of CYP2C9 gene rs1057910 locus allele-specific primers (ASP)
[0147] For the CYP2C9 gene rs1057910, wild-type and a series of mutant-specific primers were designed as follows:
[0148] CYP2C9 gene rs1057910-WT-F: ggtgcacgaggtccagagattca (SEQ No.8)
[0149] CYP2C9 gene rs1057910-mut-F: ggtgcacgaggtccagagattcc (SEQ No.9)
[0150]CYP2C9 gene rs1057910-mut-F1: gtgcacgaggtccagagattcc (SEQ No. 10)
[0151] CYP2C9 gene rs1057910-mut-F2: tgcacgaggtccagagattcc (SEQ No. 11)
[0152] CYP2C9 gene rs1057910-mut-F3:ggtgcacgaggtccagagatagc (SEQ No.12)
[0153] CYP2C9 gene rs1057910-mut-F4: gtgcacgaggtccagagatagc (SEQ No. 13)
[0154] CYP2C9 gene rs1057910-mut-F5: tgcacgaggtccagagatagc (SEQ No. 14)
[0155] Simultaneously design and synthesize the first probe specific to CYP2C9 gene Taqman:
[0156] SEQ No. 15: FAM-ccaccagcctgccccatgcagtg-BHQ1.
[0157] Relevant primers and probes were synthesized at Sangon Bioengineering (Shanghai) C...
Embodiment 3
[0160] Example 3: Sensitivity screening of ASP at rs1057910 site of CYP2C9 gene
[0161] Then use mutant primers to pair with the first downstream primer SEQ No.16 respectively, and use mutant recombinant plasmids according to 10 6 , 10 5 , 10 4 , 10 3 , 10 2 , 10, 0 for serial dilution, plus Taqman-specific probes, sensitivity verification was performed on a fluorescent quantitative PCR instrument. The mutation-specific primer can detect 100 copies of the mutant, so this primer is the best primer for detecting the rs1057910 site of the CYP2C9 gene screened according to our method, as shown in Table 3.
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com