Multi-control sterility expression vector constructed on basis of Ms7 gene and method for using multi-control sterility expression vector for keeping and reproducing corn recessive genic male sterile lines

A construct and corn technology, applied in the field of molecular biology and plant genetic engineering, can solve the problems of production reduction, cost increase, economic loss, etc.

Active Publication Date: 2015-10-28
BEIJING SHOU JIA LI HUA SCI TECH CO LTD +1
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Artificial detasseling is relatively easy, and mechanical detasseling and chemical detasseling can also be used. However, these strategies also have some problems: on the one hand, these techniques greatly increase the cost of seed production; Thorough or untimely, it will reduce the purity of hybrid...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Multi-control sterility expression vector constructed on basis of Ms7 gene and method for using multi-control sterility expression vector for keeping and reproducing corn recessive genic male sterile lines
  • Multi-control sterility expression vector constructed on basis of Ms7 gene and method for using multi-control sterility expression vector for keeping and reproducing corn recessive genic male sterile lines
  • Multi-control sterility expression vector constructed on basis of Ms7 gene and method for using multi-control sterility expression vector for keeping and reproducing corn recessive genic male sterile lines

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Example 1: Construction of multiple control sterility vectors pMCS0701, pMCS0702 and pMCS0703

[0050] 1. Construction of multi-control sterile vector pMCS0701 containing 5 expression cassettes

[0051] 1) Construct an expression cassette containing fluorescent protein marker gene mCherry (Ltp2:mCherry, SEQ ID NO.1)

[0052] and the intermediate loading of the expression cassette of the herbicide resistance gene Bar (CaMV35SPro:Bar, SEQ ID NO.2)

[0053] Body pCLC.

[0054] Using pMD18-Ltp2 as a template to amplify the Ltp2 fragment, the primers used are:

[0055] oligo01: 5'-ca aagctt ctctagaactagtggatctcgatgtgtag

[0056] (AAGCTT is the HindIII restriction site);

[0057] oligo02: 5'-ct ggtcaccagatct tactcggctacactcacac

[0058] (GGTCACC is the BstEII restriction site, AGATCT is the BglII restriction site).

[0059] pCambia3301 is one of the pCambia series vectors, which contains the expression cassette of the herbicide resistance gene Bar. The Lt...

Embodiment 2

[0109] Example 2: Application of Maize Multi-Control Sterile Vectors pMCS0701, pMCS0702 and pMCS0703

[0110] 1. Maize multi-control sterile vector transformation Agrobacterium

[0111] Referring to the method of AN (Methods in Enzymology (1987) 153:292-305), the multi-control sterile vectors pMCS0701, pMCS0702 and pMCS0703 constructed in the present invention were transformed into Agrobacterium EHA105 (Hood et al., Transgenic Res (1993) 2 :208-218).

[0112] Take 1-2 ug of the plasmid, add it to 100 ul of Agrobacterium EHA105 competent cells melted on ice, and keep in ice bath for 30 min. Quickly freeze in liquid nitrogen for 1 minute, transfer to 37°C water bath for 5 minutes; add 1000 ul YEB liquid medium after rapid ice bath for 2 minutes, culture at 28°C for 2-4 hr at 200 rpm, coat with Culture on solid YEB plates containing 50 mg / L Rifampicin and 100 mg / L Kanamycin for 2-3 days. After a single colony grows, pick a single colony and inoculate it in YEB liquid mediu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a multi-control sterility expression vector which is constructed through an Ms7 gene and used for recovering, keeping and reproducing corn recessive genic male sterile lines, and an application method of the multi-control sterility expression vector, and belongs to the field of plant genetic engineering in the biotechnology. The multi-control sterility expression vector mainly comprises four functional elements, namely, the fertility reproducing gene functional element for corn male sterility, the functional element used for restraining corn male gametophyte formation, the cone peel color screening and marking functional element, and the herbicide resistance gene functional element. The constructed vector is introduced into corn receptors such as cells, callus or organs, can be used for recovering, keeping and reproducing the male sterility lines of corn, is expected to be applied to corn sterile cross breeding and cross hybrid seed production, and generates great economical value in the corn production.

Description

technical field [0001] Generally, the present invention is in the fields of molecular biology and plant genetic engineering. Specifically, the present invention relates to a fertility restorer gene for restoring male sterile maize fertility Ms7 The construct, the recombinant vector comprising the construct, and the host cell transformed with the construct or the recombinant vector, the transgenic plant cell and the preparation method of transgenic corn, and the maize male sterile line seed and maintainer line produced therefrom seed. Background technique [0002] Heterosis is the phenomenon in which a hybrid is superior to its two parents in one or more traits. For example, the first generation of hybrids obtained by crossing different strains, different varieties, or even different species often exhibit stronger growth rate and metabolic functions than their parents, resulting in developed organs, increased body size, increased yield, or resistance to disease. Improvemen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/82C12N5/10A01H1/02
Inventor 万向元谢科吴锁伟李金萍安学丽张丹凤肖中华刘慎思
Owner BEIJING SHOU JIA LI HUA SCI TECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap