Multi-control sterility expression vector constructed on basis of Ms7 gene and method for using multi-control sterility expression vector for keeping and reproducing corn recessive genic male sterile lines
A construct and corn technology, applied in the field of molecular biology and plant genetic engineering, can solve the problems of production reduction, cost increase, economic loss, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0049] Example 1: Construction of multiple control sterility vectors pMCS0701, pMCS0702 and pMCS0703
[0050] 1. Construction of multi-control sterile vector pMCS0701 containing 5 expression cassettes
[0051] 1) Construct an expression cassette containing fluorescent protein marker gene mCherry (Ltp2:mCherry, SEQ ID NO.1)
[0052] and the intermediate loading of the expression cassette of the herbicide resistance gene Bar (CaMV35SPro:Bar, SEQ ID NO.2)
[0053] Body pCLC.
[0054] Using pMD18-Ltp2 as a template to amplify the Ltp2 fragment, the primers used are:
[0055] oligo01: 5'-ca aagctt ctctagaactagtggatctcgatgtgtag
[0056] (AAGCTT is the HindIII restriction site);
[0057] oligo02: 5'-ct ggtcaccagatct tactcggctacactcacac
[0058] (GGTCACC is the BstEII restriction site, AGATCT is the BglII restriction site).
[0059] pCambia3301 is one of the pCambia series vectors, which contains the expression cassette of the herbicide resistance gene Bar. The Lt...
Embodiment 2
[0109] Example 2: Application of Maize Multi-Control Sterile Vectors pMCS0701, pMCS0702 and pMCS0703
[0110] 1. Maize multi-control sterile vector transformation Agrobacterium
[0111] Referring to the method of AN (Methods in Enzymology (1987) 153:292-305), the multi-control sterile vectors pMCS0701, pMCS0702 and pMCS0703 constructed in the present invention were transformed into Agrobacterium EHA105 (Hood et al., Transgenic Res (1993) 2 :208-218).
[0112] Take 1-2 ug of the plasmid, add it to 100 ul of Agrobacterium EHA105 competent cells melted on ice, and keep in ice bath for 30 min. Quickly freeze in liquid nitrogen for 1 minute, transfer to 37°C water bath for 5 minutes; add 1000 ul YEB liquid medium after rapid ice bath for 2 minutes, culture at 28°C for 2-4 hr at 200 rpm, coat with Culture on solid YEB plates containing 50 mg / L Rifampicin and 100 mg / L Kanamycin for 2-3 days. After a single colony grows, pick a single colony and inoculate it in YEB liquid mediu...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap