Circular RNA-met gene in liver cancer and its preparation method and fluorescent quantitative PCR detection method

A fluorescent quantitative detection, circular technology, applied in the direction of DNA preparation, biochemical equipment and methods, DNA / RNA fragments, etc., can solve the problem of no further research and achieve high specificity

Active Publication Date: 2016-10-26
GUANGZHOU GENESEED BIOTECH +1
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Circularization of the RNA of the MET gene was found by searching the specialized circular RNA database (http: / / circrna.org / ); however, no further studies have been conducted in this area

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Circular RNA-met gene in liver cancer and its preparation method and fluorescent quantitative PCR detection method
  • Circular RNA-met gene in liver cancer and its preparation method and fluorescent quantitative PCR detection method
  • Circular RNA-met gene in liver cancer and its preparation method and fluorescent quantitative PCR detection method

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0063] A method for preparing circular RNA-MET gene in liver cancer, the preparation method comprising the following steps:

[0064] 1) Extracting total RNA in cells and tissues: extracting total RNA in liver cancer cells and liver cancer tissues;

[0065] 2) Removing the remaining genomic DNA in the extracted RNA: add the reaction solution to the total RNA extracted above, and remove the remaining genomic DNA after digestion and inactivation;

[0066] 3) Reverse transcribe RNA into cDNA: add the above RNA into a PCR tube as a template, use random reverse transcription primers, and reverse transcribe into cDNA in a PCR system;

[0067] 4) Primer design and PCR amplification, cloning and sequencing

[0068] Design PCR amplification primers, the primer sequence is MET-F: 5'CCAGATTCTGC CGAACCAATG 3', MET-R1: 5'GCTCCTCTGCACCAAGGTAA 3'; select the β-actin gene as the internal reference gene, as the correction gene of the fluorescence quantitative result data, the sequence is as fo...

Embodiment 1

[0098] A method for preparing circular RNA-MET gene in liver cancer, comprising the following steps

[0099] 1) extract the total RNA in cells and tissues, according to The Reagent reagent operating instructions extract the total RNA in liver cancer cells and liver cancer tissues; the detailed steps of extraction are:

[0100] a) Take 2 mg of liver cancer tissue, grind the tissue with liquid nitrogen until pulverized, transfer it to a 1.5ml centrifuge tube, add 1ml trizol; take about 1 million cells of liver cancer cells, add 1ml trizol;

[0101] b) Add 200 μL of chloroform, shake vigorously for 15 seconds, and let stand at room temperature for 15 minutes;

[0102] c) Centrifuge at 12000g for 15min at 4°C, the solution is divided into three layers, the RNA is dissolved in the water phase, and the water phase is transferred to another new RNase free EP tube;

[0103] d) Add 1 volume of isopropanol, vortex and mix thoroughly;

[0104] e) Centrifuge at 12000g for 10min at 4°C...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a circular RNA-MET gene in liver cancer as well as an expression method and a fluorescent quantitative PCR (polymerase chain reaction) detection method of the circular RNA-MET gene. The cDNA nucleotide sequence of the circular RNA-MET gene in the liver cancer is shown by SEQ ID NO:1. By designing a specific primer capable of amplifying the circular RNA, the circular RNA of the MET gene is amplified out by PCR, and an accurate cyclization site of circular RNA-MET is measured by a method for sequencing a PCR product namely cloned DNA; and the MET gene is determined to objectively contain the circular RNA consisting of 1214 nucleotides. By using the fluorescent quantitative PCR detection method of the circular RNA-MET gene in the liver cancer, the existence and expressive differences of the circular RNA-MET in samples of liver cancer cells and liver cancer clinical tissues can be specifically detected. The invention can provide an ideal gene detection method for early clinical diagnosis of liver cancer.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a circular RNA-MET gene in liver cancer, a preparation method thereof and a fluorescent quantitative PCR detection method; it provides a basis for early diagnosis and classification of liver cancer. Background technique [0002] Circular RNAs (circRNAs) in organisms are a class of RNAs with special and unknown functions, and exist in large numbers objectively. Circular RNAs are formed by shearing precursor RNAs and then head-to-tail connections of linear RNAs. Due to technical limitations in previous studies, this part of objectively existing RNAs has been ignored. With the development of deep RNA sequencing and large-scale biological With the development of information technology, researchers have really discovered that there are a large number of circularized RNA molecules in organisms. Due to the formation of closed loops, circularized RNAs are very stable in organisms. The speci...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/113C07K7/64C12N15/10C12Q1/68
Inventor缪辉来张茂雷
OwnerGUANGZHOU GENESEED BIOTECH