Supercharge Your Innovation With Domain-Expert AI Agents!

Application of genes in oilseed rape NF-YB gene family

A technology of NF-YB and gene family, applied in application, genetic engineering, plant genetic improvement, etc., can solve the problems of not too many, not deep functions, etc.

Inactive Publication Date: 2015-11-18
NANJING AGRICULTURAL UNIVERSITY
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0011] At present, there are not too many reports on the NF-YB family genes of rapeseed, and the research on their functions is not in-depth. Our current research has laid a foundation for others and subsequent functional research.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of genes in oilseed rape NF-YB gene family
  • Application of genes in oilseed rape NF-YB gene family
  • Application of genes in oilseed rape NF-YB gene family

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1. High-fidelity PCR amplification of the BnNF-YB2 / 3 / 4 / 5 / 6 target gene

[0040] The young leaves of Brassica napus at the leaf stage were taken, and the total plant RNA was extracted according to the instructions of the OMEGAplant RNA extraction kit, and the cDNA template was obtained by reverse transcription with the TaKaRa reverse transcription kit in two steps. BnNF-YB2 / 3 / 4 / 5 / 6 were amplified by high-fidelity PCR with the following primers, and the results were as follows figure 1 . The obtained BnNF-YB2 gene cDNA sequence is shown in SEQ ID NO.1, the BnNF-YB3 gene cDNA sequence is shown in SEQ ID NO.2, the BnNF-YB4 gene cDNA sequence is shown in SEQ ID NO.3, and the BnNF-YB5 gene cDNA sequence is shown in SEQ ID NO.4 As shown, the cDNA sequence of the BnNF-YB6 gene gene is shown in SEQ ID NO.5.

[0041] BnNF-YB2-F:CATGCCATGGGGGATTCCGACAAGG

[0042] BnF-YB2-R: ACTAGTAGTTTCTAGTCCTACCGGAGCCAG

[0043] BnNF-YB3–F:CATGCCATGGGAGATTCCGACAGAGATTC

[0044] BnNF...

Embodiment 2

[0062] Embodiment 2. Contain the construction of target gene expression vector

[0063] The pEASY-BluntCloningvector containing the target genes (BnNF-YB2, BnNF-YB3, BnNF-YB4, BnNF-YB5, and BnNF-YB6) and the expression vector BinaryvectorpCAMBIA-1302 were double-digested with restriction enzymes SpeI and NcoI, respectively.

[0064] The double enzyme digestion system (20.0 μL) is as follows:

[0065]

[0066] Digest at 37°C for 3 hours, add 2.2 μL of 10×loadingbuffer, and perform 1% agarose gel electrophoresis to recover and purify the digested target DNA fragments (BnNF-YB2, BnNF-YB3, BnNF-YB4, BnNF-YB5, BnNF-YB6 and BinaryvectorpCAMBIA-1302, see figure 2 ).

[0067] The BnNF-YB2, BnNF-YB3, BnNF-YB4, BnNF-YB5, BnNF-YB6 DNA fragments and BinaryvectorpCAMBIA-1302 DNA fragments obtained by restriction enzyme digestion were respectively ligated with T4 ligase. T4 ligase ligation system (25.0 μL):

[0068]

[0069]

[0070] 16°C overnight.

[0071] Take 10 μL of the...

Embodiment 3

[0072] Example 3. Transformation of expression vectors into Agrobacterium tumefaciens by electroporation

[0073] 1. Soak the 0.1cm electric cup in 70% alcohol solution for one day, then blow and wash it with 70% alcohol solution in the ultra-clean bench for 6-7 times, then blow and wash it with sterile water for 3-4 times, and then clean it Put it in an ultra-clean bench and blow dry (3~5h);

[0074] 2. Cover the dried electric cup and place it at -20°C for 20 minutes;

[0075] 3. Put the frozen electroporation cup on ice, and add 10 μL plasmid and 40 μL Agrobacterium tumefaciens EHA105 competent respectively in a clean bench;

[0076] 4. Adjust the electrotransformer to the "Agr" file for electrotransformation;

[0077] 5. Take out the transformed Agrobacterium from the electro-cup into a new sterile 1.5mL centrifuge tube, add 600μL of YEP medium, 30°C, 200rpm, resume culture for 3-4h;

[0078] 6. Centrifuge at 5000rpm for 1min, then discard 400μL supernatant, resuspend t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of genes in the oilseed rape NF-YB gene family, particularly application of five genes in the oilseed rape NF-YB gene family, namely BnNF-YB2, BnNF-YB3, BnNF-YB4, BnNF-YB5 and BnNF-YB6, in promoting precocious flowering of plants, increasing root elongation and improving plant stress resistance. Experimental research results show that the genes BnNF-YB2 / 3 / 4 / 5 / 6 participate in controlling the photoperiod and flowing time of the plants, all the genes can promote precocious flowering of Arabidopsis thaliana and play a control role in plant stress resistance approaches; overexpressed Arabidopsis thaliana has a higher root elongation than wild Arabidopsis thaliana; under salt and drought stress, compared with the wild Arabidopsis thaliana, the overexpressed Arabidopsis thaliana still has an increased root elongation; thus, certain theoretical basis is provided for the cultivation of novel varieties of salt-tolerant drought-tolerant oilseed rape.

Description

technical field [0001] The invention belongs to the field of bioengineering and relates to the application of rapeseed NF-YB gene family genes. Background technique [0002] Eukaryotes not only need RNA polymerase, but also need the assistance of various protein factors during transcription, and these protein factors are called transcription factors. Transcription factors, also known as trans-acting factors, are a group of specific sequences that can specifically bind to a specific sequence (cis-acting element) upstream of the 5' end or downstream of the 3' end of a gene. Expression acts as an inhibitor or enhancer, thereby ensuring that the target gene is expressed at a specific time and space with a specific intensity. Generally, transcription factors can be divided into two categories: general transcription factors and specific transcription factors (including transcription activators and transcription repressors). NF-Y, full name NuclearFactorY, is a type of specific t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/82A01H5/00
Inventor 梁明祥付蕊欣殷祥贞
Owner NANJING AGRICULTURAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More