Application of genes in oilseed rape NF-YB gene family
A technology of NF-YB and gene family, applied in application, genetic engineering, plant genetic improvement, etc., can solve the problems of not too many, not deep functions, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Example 1. High-fidelity PCR amplification of the BnNF-YB2 / 3 / 4 / 5 / 6 target gene
[0040] The young leaves of Brassica napus at the leaf stage were taken, and the total plant RNA was extracted according to the instructions of the OMEGAplant RNA extraction kit, and the cDNA template was obtained by reverse transcription with the TaKaRa reverse transcription kit in two steps. BnNF-YB2 / 3 / 4 / 5 / 6 were amplified by high-fidelity PCR with the following primers, and the results were as follows figure 1 . The obtained BnNF-YB2 gene cDNA sequence is shown in SEQ ID NO.1, the BnNF-YB3 gene cDNA sequence is shown in SEQ ID NO.2, the BnNF-YB4 gene cDNA sequence is shown in SEQ ID NO.3, and the BnNF-YB5 gene cDNA sequence is shown in SEQ ID NO.4 As shown, the cDNA sequence of the BnNF-YB6 gene gene is shown in SEQ ID NO.5.
[0041] BnNF-YB2-F:CATGCCATGGGGGATTCCGACAAGG
[0042] BnF-YB2-R: ACTAGTAGTTTCTAGTCCTACCGGAGCCAG
[0043] BnNF-YB3–F:CATGCCATGGGAGATTCCGACAGAGATTC
[0044] BnNF...
Embodiment 2
[0062] Embodiment 2. Contain the construction of target gene expression vector
[0063] The pEASY-BluntCloningvector containing the target genes (BnNF-YB2, BnNF-YB3, BnNF-YB4, BnNF-YB5, and BnNF-YB6) and the expression vector BinaryvectorpCAMBIA-1302 were double-digested with restriction enzymes SpeI and NcoI, respectively.
[0064] The double enzyme digestion system (20.0 μL) is as follows:
[0065]
[0066] Digest at 37°C for 3 hours, add 2.2 μL of 10×loadingbuffer, and perform 1% agarose gel electrophoresis to recover and purify the digested target DNA fragments (BnNF-YB2, BnNF-YB3, BnNF-YB4, BnNF-YB5, BnNF-YB6 and BinaryvectorpCAMBIA-1302, see figure 2 ).
[0067] The BnNF-YB2, BnNF-YB3, BnNF-YB4, BnNF-YB5, BnNF-YB6 DNA fragments and BinaryvectorpCAMBIA-1302 DNA fragments obtained by restriction enzyme digestion were respectively ligated with T4 ligase. T4 ligase ligation system (25.0 μL):
[0068]
[0069]
[0070] 16°C overnight.
[0071] Take 10 μL of the...
Embodiment 3
[0072] Example 3. Transformation of expression vectors into Agrobacterium tumefaciens by electroporation
[0073] 1. Soak the 0.1cm electric cup in 70% alcohol solution for one day, then blow and wash it with 70% alcohol solution in the ultra-clean bench for 6-7 times, then blow and wash it with sterile water for 3-4 times, and then clean it Put it in an ultra-clean bench and blow dry (3~5h);
[0074] 2. Cover the dried electric cup and place it at -20°C for 20 minutes;
[0075] 3. Put the frozen electroporation cup on ice, and add 10 μL plasmid and 40 μL Agrobacterium tumefaciens EHA105 competent respectively in a clean bench;
[0076] 4. Adjust the electrotransformer to the "Agr" file for electrotransformation;
[0077] 5. Take out the transformed Agrobacterium from the electro-cup into a new sterile 1.5mL centrifuge tube, add 600μL of YEP medium, 30°C, 200rpm, resume culture for 3-4h;
[0078] 6. Centrifuge at 5000rpm for 1min, then discard 400μL supernatant, resuspend t...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
