PCR (polymerase chain reaction) detection primer and reagent kit for camellia root-knot nematode
A technology of camellia root-knot nematode and detection kit, applied in the direction of DNA/RNA fragments, recombinant DNA technology, etc., can solve the problem of high detection cost, and achieve the effect of high sensitivity, strong specificity and low cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0011] The PCR detection kit of embodiment 1, camellia root-knot nematode
[0012] 100 or 200 reaction system, 50μL reaction system includes: Mg-free 2+ 5.0 μl of 10x PCR buffer with a concentration of 25 mM MgCl 2 5.0 μL solution, 4.0 μL dNTP solution with a concentration of 0.1 mM, 0.6 μL Taq enzyme solution with a concentration of 5 U / μL, 3.0 μL each of upstream primer solution and downstream primer solution with a concentration of 10 μM. Taq enzyme solution and dNTP solution were purchased from Treasure Bioengineering (Dalian) Co., Ltd., wherein the upstream primer solution contained a primer with the nucleotide sequence TTCGAGAAACTTGGGGACCG, and the downstream primer solution contained a primer with the nucleotide sequence ATGTCCTCAAACGCGTCACT.
Embodiment 2
[0013] Embodiment 2, DNA extraction method
[0014] Pick a single nematode and put it into a 200 μL PCR tube [with 10 μL double distilled water and 5 μL 10×PCR buffer (without Mg 2+ )], placed in liquid nitrogen for more than 1 min (or -70 °C for 0.5 h), and immediately heated at 85 °C for 2 min after taking it out. Then add 1 μL of 1 mg / mL proteinase K to the PCR tube, heat at 56°C for more than 30 minutes, and heat at 95°C for 10 minutes to obtain a DNA template.
Embodiment 3
[0015] Embodiment 3, PCR detection method
[0016] Use the PCR detection kit of camellia root-knot nematode to detect, and the PCR reaction system is: no Mg 2+ 5.0 μl of 10x PCR buffer with a concentration of 25 mM MgCl 2 5.0 μL solution, 4.0 μL dNTP solution with a concentration of 0.1 mM, 0.6 μL Taq enzyme solution with a concentration of 5 U / μL, 3.0 μL each of upstream primer solution and downstream primer solution with a concentration of 10 μM, DNA template 1.0-3.0 μL, ddH 2 O make up 50 μL. PCR reaction conditions: 94°C for 4min; 94°C for 40sec, 52°C for 1min, 72°C for 1.5min, 36 cycles; 72°C for 8min. Electrophoresis: 5 μL of PCR products were separated by 1.0% (weight / volume) agarose gel electrophoresis, stained with DNA dyes, and visualized under an ultraviolet gel imaging system. If the specific fragment size was 361bp, it was root-knot nematode camellia.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 