PCR (polymerase chain reaction) detection primer and reagent kit for camellia root-knot nematode

A technology of camellia root-knot nematode and detection kit, applied in the direction of DNA/RNA fragments, recombinant DNA technology, etc., can solve the problem of high detection cost, and achieve the effect of high sensitivity, strong specificity and low cost

Inactive Publication Date: 2015-11-25
NINGBO ACAD OF SCI & TECH FOR INSPECTION & QUARANTINE
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, in addition to morphological identification for the detection of root-knot nematode camellia, the invention patent application with publication number CN103924001 discloses a LAMP method for rapid detection of root-knot nematode camellia, although it is specific and sensitive, but the detection cost is relatively high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0011] The PCR detection kit of embodiment 1, camellia root-knot nematode

[0012] 100 or 200 reaction system, 50μL reaction system includes: Mg-free 2+ 5.0 μl of 10x PCR buffer with a concentration of 25 mM MgCl 2 5.0 μL solution, 4.0 μL dNTP solution with a concentration of 0.1 mM, 0.6 μL Taq enzyme solution with a concentration of 5 U / μL, 3.0 μL each of upstream primer solution and downstream primer solution with a concentration of 10 μM. Taq enzyme solution and dNTP solution were purchased from Treasure Bioengineering (Dalian) Co., Ltd., wherein the upstream primer solution contained a primer with the nucleotide sequence TTCGAGAAACTTGGGGACCG, and the downstream primer solution contained a primer with the nucleotide sequence ATGTCCTCAAACGCGTCACT.

Embodiment 2

[0013] Embodiment 2, DNA extraction method

[0014] Pick a single nematode and put it into a 200 μL PCR tube [with 10 μL double distilled water and 5 μL 10×PCR buffer (without Mg 2+ )], placed in liquid nitrogen for more than 1 min (or -70 °C for 0.5 h), and immediately heated at 85 °C for 2 min after taking it out. Then add 1 μL of 1 mg / mL proteinase K to the PCR tube, heat at 56°C for more than 30 minutes, and heat at 95°C for 10 minutes to obtain a DNA template.

Embodiment 3

[0015] Embodiment 3, PCR detection method

[0016] Use the PCR detection kit of camellia root-knot nematode to detect, and the PCR reaction system is: no Mg 2+ 5.0 μl of 10x PCR buffer with a concentration of 25 mM MgCl 2 5.0 μL solution, 4.0 μL dNTP solution with a concentration of 0.1 mM, 0.6 μL Taq enzyme solution with a concentration of 5 U / μL, 3.0 μL each of upstream primer solution and downstream primer solution with a concentration of 10 μM, DNA template 1.0-3.0 μL, ddH 2 O make up 50 μL. PCR reaction conditions: 94°C for 4min; 94°C for 40sec, 52°C for 1min, 72°C for 1.5min, 36 cycles; 72°C for 8min. Electrophoresis: 5 μL of PCR products were separated by 1.0% (weight / volume) agarose gel electrophoresis, stained with DNA dyes, and visualized under an ultraviolet gel imaging system. If the specific fragment size was 361bp, it was root-knot nematode camellia.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a PCR (polymerase chain reaction) detection primer and a reagent kit for camellia root-knot nematode. The PCR detection primer mainly comprises a pair of specific primers. Nucleotide sequences of upstream primers are TTCGAGAAAC TTGGGGACCG, and nucleotide sequences of downstream primers are ATGTCCTCAA ACGCGTCACT. The PCR detection primer and the reagent kit have the advantages that the specific primers are specific and sensitive to the camellia root-knot nematode, the sizes of amplified specific fragments are 361bp, and the specific primers are free of specific bands and fragments for other root-knot nematode; detection can be completed within 4 hours by the aid of the specific primers and the reagent kit, and accordingly the PCR detection primer and the reagent kit are high in specificity, sensitivity and practicality and low in cost.

Description

technical field [0001] The invention relates to the detection technology of root-knot nematode, in particular to a PCR detection primer and kit for root-knot nematode of camellia. Background technique [0002] Root-knot nematodes ( Meloidogyne Goeldi, 1887) is an obligate endoparasitic nematode of plant roots, which is one of the most diverse, widely distributed and most harmful groups of plant pathogenic nematodes, and has very important economic significance. In 2007, my country included root-knot nematode (non-Chinese species) in the List of Imported Plant Quarantine Pests of the People's Republic of China, and implemented strict quarantine at ports to protect my country's agricultural and ecological safety. There are currently 98 known species of root-knot nematodes, most of which have not been found in my country and are important quarantine nematodes. Camellia root-knot nematode Meloidogyne camelliae Golden 1978 was first intercepted by Ningbo Port in 2012 from cam...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6888
Inventor 顾建锋陈先锋何洁
Owner NINGBO ACAD OF SCI & TECH FOR INSPECTION & QUARANTINE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap