Dental caries vaccine and method for preparing same

A caries, vaccine technology, applied in the field of vaccines

Inactive Publication Date: 2016-01-06
鄢慧民 +4
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the past, rat dental caries models were immunized before and 3-5 days after rats completed oral cavity determination, and then the protective effect was evaluated, so it can only be called a preventive caries vaccine rat model

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Dental caries vaccine and method for preparing same
  • Dental caries vaccine and method for preparing same
  • Dental caries vaccine and method for preparing same

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] 1. Materials and methods

[0030] 1. Construction of pET28a-KFD2-PAc-Glu plasmid

[0031] First, using the plasmid pGJA-P / VAX expressing the virulence factor Glu of Streptococcus mutans (S.mutans) as a template, the Glu fragment was amplified by PCR, and the upstream primer was: CGC AAGCTT GAAATGGGCTATCAAGCCAAAG (SEQ ID NO: 6), the downstream primer is: ACTA CTCGAG AATCCGAACTCGTTTCCAG (SEQ ID NO: 7), respectively introduced HindIII and XhoI2 restriction sites in the upstream and downstream (the underline represents the restriction site), and then the fragment was connected into the constructed plasmid pET28a-KFD2-PAc, wherein The DNA sequence of the antigen derived from the mutans surface protein Pac of constructing plasmid pET28a-KFD2-Pac is shown in SEQ ID NO: 1, the DNA sequence of the adjuvant derived from flagellin is shown in SEQ ID NO: 2, and the ligation product is transformed into BL21 (DE3 )star; positive clones were picked for enzyme digestion and sequenc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses dental caries vaccine. The dental caries vaccine is a recombinant protein. Antigenic DNA (deoxyribonucleic acid) sequences derived from surface proteins PAc of streptococcus mutans are inserted in downstream 3' ends of DNA sequences of adjuvants derived from flagellin or replace all hypermutation regions of the DNA sequences of the adjuvants derived from the flagellin, and the antigenic DNA sequences and antigenic DNA sequences derived from glucosyltransferase of the streptococcus mutans are connected with one another and then are jointly expressed to obtain the recombinant protein. The dental caries vaccine has the advantages that rat models for the therapeutic dental caries vaccine are built, virulence factors PAc and Glu of the streptococcus mutans are used as vaccine antigens, flagellin proteins (KF) of recombinant bacteria are used as mucosal adjuvants, immune response effects and anti-caries protection effects of the PAc, KF-PAc and KFD2-PAc-Glu are systematically studied and compared, the KFD2-PAc-Glu is the relatively optimal therapeutic vaccine as shown by results, and in other words, the dental caries vaccine is the relatively optimal therapeutic vaccine.

Description

technical field [0001] The invention relates to a vaccine, in particular to a dental caries vaccine and a preparation method thereof. Background technique [0002] Dental caries is a chronic infectious disease caused by bacterial infection, which exists in a wide range and poses a huge hazard to health. The measures adopted for caries prevention mainly include two aspects: strengthening oral public health and using anti-caries vaccines. With the increasing awareness of the dangers of dental caries, research on anti-caries vaccines has received more and more attention, and will become an important means of effectively controlling dental caries in the future. After decades of intensive research, Streptococcus mutans ( streptococcus mutans (S. mutans) ) has been identified as the main cariogenic pathogen, and its pathogenic mechanism is: after the bacteria adhere and enrich on the tooth surface, the lactic acid produced by metabolism decalcifies the enamel, and then invades t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): A61K39/39A61K39/09A61K48/00A61P31/04A61P1/02C07K14/315
Inventor 鄢慧民钟茂华杨菁毅包容孙颖
Owner 鄢慧民
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap