Dental caries vaccine and method for preparing same
A caries, vaccine technology, applied in the field of vaccines
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] 1. Materials and methods
[0030] 1. Construction of pET28a-KFD2-PAc-Glu plasmid
[0031] First, using the plasmid pGJA-P / VAX expressing the virulence factor Glu of Streptococcus mutans (S.mutans) as a template, the Glu fragment was amplified by PCR, and the upstream primer was: CGC AAGCTT GAAATGGGCTATCAAGCCAAAG (SEQ ID NO: 6), the downstream primer is: ACTA CTCGAG AATCCGAACTCGTTTCCAG (SEQ ID NO: 7), respectively introduced HindIII and XhoI2 restriction sites in the upstream and downstream (the underline represents the restriction site), and then the fragment was connected into the constructed plasmid pET28a-KFD2-PAc, wherein The DNA sequence of the antigen derived from the mutans surface protein Pac of constructing plasmid pET28a-KFD2-Pac is shown in SEQ ID NO: 1, the DNA sequence of the adjuvant derived from flagellin is shown in SEQ ID NO: 2, and the ligation product is transformed into BL21 (DE3 )star; positive clones were picked for enzyme digestion and sequenc...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap