Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of lepidopteron chitin synthetase CHSA-2b/19b in pest control

A chitin synthase, lepidopteran technology, applied in the application, insecticide, biocide and other directions, can solve the problem of unclear function of CHSA-2b, no report, etc.

Active Publication Date: 2016-01-13
SOUTH CHINA NORMAL UNIVERSITY
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But the function of CHSA-2b remains unclear
And so far there is no report on the function of epidermal chitinase in different cutting modes in insect wing development

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of lepidopteron chitin synthetase CHSA-2b/19b in pest control
  • Application of lepidopteron chitin synthetase CHSA-2b/19b in pest control
  • Application of lepidopteron chitin synthetase CHSA-2b/19b in pest control

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1 Bombyx mori wing deformity in which BmCHSA-2b is suppressed

[0030] (1) silkworm BmCHSA-2b and BmCHSA-19b dsRNA synthesis

[0031] According to the instructions of the kit T7RiboMAX? ExpressRNAiSystem (purchased from Promega) to synthesize silkworm BmCHSA-2b dsRNA, BmCHSA-19b dsRNA and GFP dsRNA, the sequence of each dsRNA is as follows.

[0032] 1) Exon of silkworm CHSA 2bThe cDNA sequence is:

[0033] ATTATGAGTGAACAAGAACGTAGGAGTCAATACGAGAACGAGGAGACGGAGGAAGTCGTTTACATTCCAAATAACAATTACTCGATATACAGTAATGGAACTTTGCATTACTGTAGCATATACAG (SEQ ID NO: 1).

[0034] 2) silkworm BmCHSA-2b dsRNA (hereinafter referred to as dsBmCHSA-2b ) sequence is:

[0035] GGAGACGGAGGAAGUCGUUUACAUUCCAAAUAACAAUUACUCGAUAUACAGUAAUGGAACUUUGCAUUACUGUAGCAUAUACAGUCAGCGCACAGUACAAGAAACGAAAGGAUGGGACGUGUUCAGAGAAUUUCCGCCGAAACAGGACAGUGUGUCCAUGGAGACUCAGAAAUGUUUGGAAUUCACAGUGCGAAUGUUAAAAGUGGUCGCUUACCUGGUCACCUUCAUCGUGGUCCUUGGAUCAGGAGUUAUCGCAAAGGGGACAAUUUUGUUCAUGACGUCACAAAUUAGGAAAGACAAGCGAUU...

Embodiment 2

[0063] Embodiment 2 Spodoptera litura SlCHSA-2b / 19b role in wing development

[0064] In order to prove that other species of Lepidoptera contain exons 2b, 19b Does the chitin synthase also have the same BmCHSA-2b , BmCHSA-19bThe same function, the present embodiment clones Spodoptera litura containing 2b and 19b full-length cDNA, and the exon 2b Fragments were subjected to RNAi experiments. The results showed that Spodoptera litura contains exon 2b chitin synthase has the same exon-containing 2b The same function of chitin synthase also affects pupal wing development.

[0065] (1) Spodoptera litura SlCHSA-2b cDNA sequence and SlCHSA-2b dsRNA synthesis

[0066] Spodoptera litura SlCHSA exon 2b The cDNA sequence is:

[0067] TATGAGTGATAACGATCGTAAAAGTCACTATGAAAGGGACGATGCCGAGGAACCGCTTTATGTCGCCAACAACAATAATTCAATTTACAGCAATGGGACTTTGCATTATTGTAGCATATACAG (SEQ ID NO: 6).

[0068] Spodoptera litura SlCHSA-2b dsRNA (hereinafter referred to as dsSlCHSA-2b ) sequence...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of lepidopteron chitin synthetase CHSA-2b / 19b in pest control. DsRNAs of interference exons 2b and 19b are fully injected to a lepidopteron, so insect veins are deformed, crumple and become thin, and wings become small, thereby the above phenomena show that transcription containing the 2b and / or 19b influences the growth of insect wings. An artificially synthesized substance expressed by a chitin synthetase transcript containing the 2b and / or the 19b and inhibiting the lepidopteron, or a compound screened from a plant, can be used as an inhibitor, for example, injection of the dsRNA of the CHSA-2b to the lepidopteron can realize pest control. A substance for promoting degradation of the chitin synthetase transcript containing the 2b and / or 19b in the lepidopteron, or a substance inhibiting normal effect performing of the chitin synthetase containing the 2b and / or 19b can also be used as a pesticide to realize pest control.

Description

technical field [0001] The present invention relates to the application of exons 2b and 19b of the chitin synthase gene of Lepidoptera insects in pest control, and specifically relates to the function of CHSA-2b / 19b affecting the development of pupal wings of Lepidoptera insects, so as to develop around the gene The research and development of transgenes or inhibitors can achieve the purpose of pest control by hindering the normal development of insect wings, affecting their flight, courtship and reproduction. Background technique [0002] The main component of insect skin and wings is chitin, which is the second largest biopolymer after cellulose. It is a linear polysaccharide complex composed of N-acetyl-β-D Glucosamine (β-N-Acetyl-D-glucosamine) is polymerized through β-1,4 glycosidic bonds. In arthropods, chitin is an important component of the epidermal exoskeleton, which plays an important role in the growth and development of arthropods. The content of chitin in ins...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A01N57/16A01P7/04C12N15/54
Inventor 郑思春徐关峰刘佳张婕李冬冬
Owner SOUTH CHINA NORMAL UNIVERSITY
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More