Unlock instant, AI-driven research and patent intelligence for your innovation.

Long non-coding RNA and its application in regulating the proliferation and differentiation of neural stem cells

A neural stem cell, non-coding technology, applied in nervous system cells, DNA/RNA fragments, animal cells, etc., can solve problems such as unclearness, and achieve the effect of preventing the occurrence of cerebellar disease

Inactive Publication Date: 2019-01-25
SHANGHAI JIAOTONG UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the mechanism of action of long non-coding RNA is still unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Long non-coding RNA and its application in regulating the proliferation and differentiation of neural stem cells
  • Long non-coding RNA and its application in regulating the proliferation and differentiation of neural stem cells
  • Long non-coding RNA and its application in regulating the proliferation and differentiation of neural stem cells

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028]The long non-coding RNA Sox2ot described in this application overlaps with the Sox2 gene sequence shown in SEQ ID No.1 in the mouse genome: First, we collected BL6 mouse embryonic days 12.5 days, 15.5 days, and postnatal 0 day and adult cerebral cortex [1]. Using Trizol, we extracted RNA and carried out RNA reverse transcription PCR analysis (RT-PCR) [1]. We designed PCR primers to amplify Sox2ot and Sox2 genes. Their sequence is as follows:

[0029] Sox2ot: F: 5'-TGCTACAAGACAACACCCTGA-3' (SEQ ID No.3),

[0030] R: 5'-GTTGCCTGGCTTCTCTTTTG-3' (SEQ ID No.4);

[0031] Sox2: F: 5'-TACAGCATGTCCTACTCGCA-3' (SEQ ID No.5),

[0032] R: 5'-TGGAGTGGGAGGAAGAGGTA-3' (SEQ ID No. 6).

[0033] By comparing the expression levels of Sox2ot and Sox2 at different developmental stages by RNA reverse transcription PCR analysis, we detected that the transcription factor Sox2 and non-coding RNA Sox2ot were highly expressed in the cerebral cortex tissues of mouse embryonic days 12.5 and 15....

Embodiment 2

[0036] We found that Sox2ot is expressed in mouse embryonic neural stem cells: In order to determine whether Sox2ot, like Sox2, also plays a role in the development of neural stem cells, we used in situ hybridization (in situ hybridization) to detect the expression of Sox2ot and Sox2 in mouse embryos 13.5 and Expression status in the brain at 15.5 days [3]. Through RNA synthesis in vitro, we synthesized DIG-labeled Sox2ot and Sox2 probes (probe) ( figure 2 )[2].

[0037] The sequence of the Sox2ot probe is as follows:

[0038] 5’cagcaaatggaaaatgaggtctttcttagttgcacaagagatgtctgaactctcagaccaaagccatcaaccagattctcttaagcggatcttgaggaaagtacaatttctaggttcgatctcggagttgagagctttcttctgtaatatgtctgttgcctggcttctcttttgcgtgtaccagctgcagagattttccgatttgggactacaggcttggacccgcggcgaccatgccagatcagggtgttgtcttgtagcagtttgattggcaggtaaaaagcactgaacgtgaaggctccggagcctctcgtcagcccaagctggatcactcctcaccggacagaacgagttgaaggagctcgcacttcccccctctttctccatccaaagcacggagaatccatttaggcttttcttcgaccagtctctcccatcagcgtcctgccttccg...

Embodiment 3

[0043] We found for the first time that Sox2ot induces neural stem cell differentiation: To explore the function of Sox2ot in brain development, we overexpressed Sox2ot in the cerebral cortex of embryonic day 13.5 by electroporation of mouse embryos, and then observed the neural stem cells in the cerebral cortex of embryonic day 14.5 development. The specific method is as follows:

[0044] We cloned the full-length cDNA fragment of Sox2ot (shown in SEQ ID No.2) on the pCAGIG vector by ligation of XhoI and NotI restriction sites[4]. The pCAGIG vector contains actin promoter and cytomegalovirus promoter (CMV), so it has high expression activity [4]. This plasmid is also loaded with the green fluorescent protein gene (eGFP) as a marker to track the cells after electroporation [4]. As a control, we also electroporated pCAGIG empty vector plasmid without Sox2ot.

[0045] After 13.5 days of gestation, the uterus was exposed after anesthesia. By microinjection, Sox2otDNA was inje...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the fields of physiological medicine and biological medicine, and relates to long non-coding RNA and application thereof in regulating and controlling proliferation and differentiation of neural stem cells. From a technical perspective, the invention discovers long non-coding RNASox2ot for regulating and controlling development of neural stem cells and confirms the effect of the long non-coding RNASox2ot on promoting the generation of neurons for the first time. The discovery is beneficial for people to directly change the expression of the long non-coding RNASox2ot in level in vivo, so that the development of the neural stem cells is affected; from a clinical perspective, exploration of the effect of the non-coding RNASox2ot in the neural stem cells is helpful for people to further develop clinical diagnosis reagents which are used for detecting genes having influence on the early development of brain so as to prevent the occurrence of microcephaly; and furthermore, since the non-coding RNA can be easily synthesized in vitro and the expression level of the non-coding RNA is intervened, people can directly regulate and control the proliferation and the differentiation of the neural stem cells by virtue of the non-coding RNA; therefore, a novel therapeutic method and a novel technical means are provided for the clinical development and application of the neural stem cells for treating human nervous system diseases.

Description

technical field [0001] The invention belongs to the field of physiology and biomedicine, and relates to a long non-coding RNA and its application in regulating the proliferation and differentiation of neural stem cells. Background technique [0002] The normal development of human and mouse cerebral cortex depends on the precise proliferation and differentiation of neural stem cells (neural stem cells, NSCs) and neural progenitors (neural progenitors), and the generation of neurons. This process requires precise molecular regulation. The proliferation and differentiation of neural stem cells are crucial to the normal development of the brain, and are closely related to the functions of the brain. Genetic and environmental factors can cause genetic mutations that lead to abnormal brain development. For example, polymicrogyria is caused by many small gyri. Patients generally have epilepsy, mental retardation and movement disorders. Mutations in genes involved in neural pro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N5/0797C12N5/0793C12Q1/6883A61K48/00A61P25/00
Inventor 孙涛
Owner SHANGHAI JIAOTONG UNIV