Long non-coding RNA and its application in regulating the proliferation and differentiation of neural stem cells
A neural stem cell, non-coding technology, applied in nervous system cells, DNA/RNA fragments, animal cells, etc., can solve problems such as unclearness, and achieve the effect of preventing the occurrence of cerebellar disease
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028]The long non-coding RNA Sox2ot described in this application overlaps with the Sox2 gene sequence shown in SEQ ID No.1 in the mouse genome: First, we collected BL6 mouse embryonic days 12.5 days, 15.5 days, and postnatal 0 day and adult cerebral cortex [1]. Using Trizol, we extracted RNA and carried out RNA reverse transcription PCR analysis (RT-PCR) [1]. We designed PCR primers to amplify Sox2ot and Sox2 genes. Their sequence is as follows:
[0029] Sox2ot: F: 5'-TGCTACAAGACAACACCCTGA-3' (SEQ ID No.3),
[0030] R: 5'-GTTGCCTGGCTTCTCTTTTG-3' (SEQ ID No.4);
[0031] Sox2: F: 5'-TACAGCATGTCCTACTCGCA-3' (SEQ ID No.5),
[0032] R: 5'-TGGAGTGGGAGGAAGAGGTA-3' (SEQ ID No. 6).
[0033] By comparing the expression levels of Sox2ot and Sox2 at different developmental stages by RNA reverse transcription PCR analysis, we detected that the transcription factor Sox2 and non-coding RNA Sox2ot were highly expressed in the cerebral cortex tissues of mouse embryonic days 12.5 and 15....
Embodiment 2
[0036] We found that Sox2ot is expressed in mouse embryonic neural stem cells: In order to determine whether Sox2ot, like Sox2, also plays a role in the development of neural stem cells, we used in situ hybridization (in situ hybridization) to detect the expression of Sox2ot and Sox2 in mouse embryos 13.5 and Expression status in the brain at 15.5 days [3]. Through RNA synthesis in vitro, we synthesized DIG-labeled Sox2ot and Sox2 probes (probe) ( figure 2 )[2].
[0037] The sequence of the Sox2ot probe is as follows:
[0038] 5’cagcaaatggaaaatgaggtctttcttagttgcacaagagatgtctgaactctcagaccaaagccatcaaccagattctcttaagcggatcttgaggaaagtacaatttctaggttcgatctcggagttgagagctttcttctgtaatatgtctgttgcctggcttctcttttgcgtgtaccagctgcagagattttccgatttgggactacaggcttggacccgcggcgaccatgccagatcagggtgttgtcttgtagcagtttgattggcaggtaaaaagcactgaacgtgaaggctccggagcctctcgtcagcccaagctggatcactcctcaccggacagaacgagttgaaggagctcgcacttcccccctctttctccatccaaagcacggagaatccatttaggcttttcttcgaccagtctctcccatcagcgtcctgccttccg...
Embodiment 3
[0043] We found for the first time that Sox2ot induces neural stem cell differentiation: To explore the function of Sox2ot in brain development, we overexpressed Sox2ot in the cerebral cortex of embryonic day 13.5 by electroporation of mouse embryos, and then observed the neural stem cells in the cerebral cortex of embryonic day 14.5 development. The specific method is as follows:
[0044] We cloned the full-length cDNA fragment of Sox2ot (shown in SEQ ID No.2) on the pCAGIG vector by ligation of XhoI and NotI restriction sites[4]. The pCAGIG vector contains actin promoter and cytomegalovirus promoter (CMV), so it has high expression activity [4]. This plasmid is also loaded with the green fluorescent protein gene (eGFP) as a marker to track the cells after electroporation [4]. As a control, we also electroporated pCAGIG empty vector plasmid without Sox2ot.
[0045] After 13.5 days of gestation, the uterus was exposed after anesthesia. By microinjection, Sox2otDNA was inje...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com