Method for increasing microbe intracellular inclusion accumulation amount by increasing bacteria volume

A technology of microorganisms and inclusions, which is applied in the biological field and can solve problems such as obstacles to obtaining microbial inclusions

Active Publication Date: 2016-02-17
TSINGHUA UNIV
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the small space of individual microorganisms prevents people from obtaining such microbial content in large quantities.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for increasing microbe intracellular inclusion accumulation amount by increasing bacteria volume
  • Method for increasing microbe intracellular inclusion accumulation amount by increasing bacteria volume
  • Method for increasing microbe intracellular inclusion accumulation amount by increasing bacteria volume

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0077] Example 1. Enlarging cell volume and improving content production by changing mreB, sulA and minCD genes

[0078] 1. Construction of engineering bacteria

[0079] 1. Knock out the mreB gene of the starting bacteria to construct EscherichiacoliJM109SG△mreB

[0080]With mreB-KmTF and mreB-KmTR as primers, pKD13 plasmid (recorded in the following documents: DatsenkoK&WannerB (2000) One-stepinactivationofchromosomalgenesinEscherichiacoliK-12usingPCRproducts.ProceedingoftheNationalAcademyofScienceoftheUnitedStatesofAmerica97(12):64640-6 can be obtained from the public as a template from Tsinghua University The kanamycin resistance gene and FRT site were amplified by PCR reaction with pfu enzyme, and the mreB homology arm was introduced in two sections.

[0081] Primers are:

[0082] mreB-kmTF:

[0083] 5' ATGTTGAAAAAATTTCGTGGCATGTTTTTCCAATGACTTGTCCATTGACCTGGGTACT ATT

[0084] homology arm

[0085] CCGGGGATCCGTCGACC3'

[0086] mreB-KmTR:

[0087] 5' CGCCGCCGTGCATGT...

Embodiment 2

[0234] Embodiment 2, increasing the volume of Bacillus subtilis increases the content of PHB content

[0235] 1. Construction of recombinant Bacillus subtilis 168△SigD△lytE△lytD(pBHR68)

[0236] 1. Construction of 168△SigD

[0237] Using Bacillus subtilis 168 (AnagnostopoulosandJ.Spizizen.1961.RequirementfortransformationinBacillussubtilis.J.Bacteriol.81:741-746, available to the public from Tsinghua University) as a template, the following primer pairs were used for PCR amplification:

[0238] SigD-up-F: gcatgcctgcaggtcgactagctgaaagcgcatatgttta

[0239] SigD-up-R: AGCAGATTCTTTAATTTTCCCCCTAATACCTTAATTA

[0240] SigD-down-F: ggtattaggggaaaattaaagaatctgctggaaaaag

[0241] SigD-down-R: CGAATTCGAGCTCGGTACCCAACACAGCTTTATCCGACA

[0242] The 594bp SigD upstream homology arm (sequence 15 from the 5' end 20bp-613bp nucleotide), the 588bp SigD downstream homology arm (sequence 15 from the 5' end 614bp-1201bp nucleotide), In addition, the plasmid vector pCU was double digested with ...

Embodiment 3

[0273] Example 3, Production of Proteus Escherichia coli PHB with Knockout of Genes Related to Cell Wall Synthesis

[0274] The biological functions of some high-molecular-weight penicillin-binding proteins (PBPs) of bacteria have been elucidated, but the physiological functions of low-molecular-weight PBPs are still unclear. Morphological observation of Escherichia coli with mutations in some PBPs found that the diameter, profile and topological structure of PBP5 knockout Escherichia coli were changed. When the activity of PBP3 or FtsZ is inhibited, the bacteria will grow longer. PBP5 is an enzyme that removes the terminal D-alanine residue of the peptidoglycan pentapeptide side chain. Mutations in PBP5 are not lethal, possibly due to the presence of one or more other low-molecular-weight PBPs that can Fill the vacancy of PBP5.

[0275] Penicillin-binding proteins (PBPs) are a series of key proteins in the process of peptidoglycan synthesis. There are currently 12 discovere...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a method for increasing microbe intracellular inclusion accumulation amount by increasing bacteria volume. The method can increase the accumulation amount of a microbe intracellular inclusion, which is characterized in that microbe volume is increased by reforming the gene which can influence the microbe volume, and the accumulation amount of the microbe intracellular inclusion can be increased. The experiment proves that the method can construct engineering bacteria for increasing the bacteria volume, so that output of poly(3-hydroxybutyrate)(PHB), protein, polyphosphoric acid and carboxysome can be increased, and the some engineering bacteria poly(3-hydroxybutyrate)(PHB) can reach as high as 80% of dry cell weight which is increased by 30%. According to the invention, production process is simple, cost is low, and application prospect is wide.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a method for increasing the accumulation of microbial intracellular content by increasing the volume of bacteria, the content including poly 3-hydroxybutyrate (PHB), protein, polyphosphoric acid and carbon dioxide body etc. Background technique [0002] Many inclusions synthesized by microorganisms have practical applications, such as inclusion poly-3-hydroxybutyrate (PHB) can be used as bioplastics or medical implant materials, protein inclusions can be useful enzymes or therapeutic polypeptides , The content of polyphosphoric acid can be used to extract phosphorus as a component of chemical fertilizers, and the content of carbon bodies can fix carbon dioxide. However, the small space of individual microorganisms hinders people from obtaining such microbial contents in large quantities. [0003] Currently known microbial cell division genes mainly include: ftsZ, ftsA, ftsQ, sulA, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12N15/63C12P7/62C12P21/00C12P9/00C12P3/00C12R1/19C12R1/38C12R1/07
Inventor 陈国强蒋笑然王颖吴弘谭丹
Owner TSINGHUA UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap