Application of neuropeptide sNPF (short neuropeptide F) and receptor gene thereof in bactrocera dorsalis specificity control agent
A technology of Bactrocera dorsalis and receptor genes, applied in the field of genetic engineering, can solve the problems of exacerbating the outbreak of agricultural pests, polluting the environment with pesticide residues, threatening the natural enemies of pests, etc., and achieves a good application prospect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Example 1. Obtaining the open reading frame sequence of Bacteralis dorsalis neuropeptide sNPF and its receptor
[0041] 1. Primer design and amplification of the open reading frame sequence of Bacteralis dorsalis neuropeptide sNPF and its receptor
[0042] Based on genome and transcriptome data, using bioinformatics methods, after repeated analysis and comparison of Drosophila sNPF (GenbankNo.AY626808) and its sNPFR (GenbankNo.NP524176), the Bacteralis dorsalis neuropeptide sNPF and its receptor ( sNPFR) nested PCR specific primers, the sequence is as follows:
[0043]
[0044] The total RNA of B. dorsalis was extracted with an RNA extraction kit, and reverse transcribed into cDNA with a reverse transcription kit.
[0045] Amplify Bacteralis dorsalis neuropeptide sNPF sequence: 50ul reaction system contains 24 μL deionized water, 20 μL 2×PrimeSTARMaxPremix, primers sNPF-1-F (as shown in SEQ ID NO: 1 in the sequence listing), sNPF-1-R (as shown in 2 μL each (concent...
Embodiment 2
[0058] Example 2. Determination of the binding ability of Bacteralis dorsalis neuropeptide sNPF to its receptor based on intracellular calcium ion flow detection method
[0059] 1. Construction of Bacteralis dorsalis sNPFR CHO (Chinese hamster ovary cell) cell expression plasmid
[0060] The Bacteralis dorsalis neuropeptide sNPFR plasmid and pcDNA3.1 (+) plasmid connected on the T carrier recovered in Example 1 were connected (T4 DNA ligase) after NotI single enzyme digestion respectively, and after connection, refer to The transformation method in Example 1 was transformed, and after the positive identification of the bacterial liquid was correct (PCR detection was performed with the universal primer T7 / BGH, T7: TAATACGACTCACTATAGGG, BGH: TAGAAGGCACAGTCGAGG), the plasmid was extracted with a plasmid extraction kit, and the sNPFGPCR was obtained. Fragment of the pcDNA3.1(+) plasmid.
[0061] Co-transfection:
[0062] 1) Prepare 1.5mL serum-free medium DMEM / F-12medium in EP t...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 