Unlock instant, AI-driven research and patent intelligence for your innovation.

LAMP (Loop-mediated isothermal amplification) detection primer group and kit and detection method for gene vip3A of transgenic plants

A technology of transgenic plants and detection kits, which is applied in the field of molecular biology, can solve problems such as detection methods and kits for the vip3A gene in transgenic plants that have not yet been detected, and achieve the effect of simple operation and strong specificity

Inactive Publication Date: 2016-04-13
JILIN ACAD OF AGRI SCI
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no detection method and kit for detecting vip3A gene in transgenic plants by LAMP method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • LAMP (Loop-mediated isothermal amplification) detection primer group and kit and detection method for gene vip3A of transgenic plants

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Embodiment 1 kit and detection method thereof.

[0035] Prepare the LAMP detection kit of vip3A gene according to the following formula, and the specification of each kit is 100 reactions:

[0036] (1) Detection primer solution: Synthesize outer primer F3, outer primer B3, inner primer FIP, and inner primer BIP, prepare the dry powder of primers with ultrapure water to prepare mother solutions with a concentration of 100 μmol / L, and then take 5 μL of outer primers F3, Put 5 μL of outer primer B3, 40 μL of inner primer FIP, 40 μL of inner primer BIP, and 10 μL of ultrapure water into a new 1.5mL centrifuge tube, mix well, and make 100 μL of vip3A gene LAMP detection primer solution, in which the primer sequence They are:

[0037] Outer primer F3: AGGAGGACAACCTGGAGC (SEQ ID NO: 1);

[0038] Outer primer B3: TCGTCCTTCAGGTGAATCGA (SEQ ID NO: 2);

[0039] Internal primer FIP: GCACGTACAGGGCCTTGGTGAGGCCAACAACAAGAACGC (SEQ ID NO: 3);

[0040] Internal primer BIP: TCAGCCAGTT...

Embodiment 2

[0051] Embodiment 2 The specificity experiment of kit and detection method.

[0052] Prepare the kit according to the kit preparation method described in Example 1, and carry out the specificity test for its detection method:

[0053] (1) Extraction of cry1Ie-transgenic maize IE09S034, cry1C-transgenic rice T1c-19, cry1F-transgenic maize TC1507, cry34Ab and cry35Ab-transgenic maize 59122, vip3A-transgenic MIR162, dmo-transgenic soybean MON87708, aad1-transgenic maize DAS40278-9 Genomic DNA of 8 kinds of test materials such as non-transgenic corn and non-transgenic corn, the DNA concentration was measured with ND1000 nucleic acid micrometer, and diluted to 25ng / μL with ultrapure water;

[0054] (2) In the 200 μL eight-tube tube, according to the steps described in Example 1, add 15.5 μL of ultrapure water, 1 μL of detection primer solution, 1 μL of BstDNA polymerase, and 2.5 μL of 10× reaction buffer to each tube in sequence , 3 μL of dNTPs solution, and then add 2 μL of IE09S...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an LAMP (Loop-mediated isothermal amplification) detection primer group and kit and a detection method for a gene vip3A of transgenic plants. The primer group consists of 4 specific primers and has nucleotide sequences shown in SEQ ID NO: 1-4. The detection kit comprises a detection primer solution, DNA polymerase with strand displacement activity, a 10x reaction buffer, a dNTPs solution and a color developing agent. The detection method comprises the steps of carrying out amplification on a DNA template of a sample at the temperature of 63-65 DEG C by adopting the specific primers and the DNA polymerase with strand displacement activity, and judging whether the sample contains a gene vip3A component or not by adopting a color developing agent added color change observing method. The detection primer group and kit and the detection method do not need special instruments, have the characteristics of rapidness, high efficiency, simplicity and convenience in operation, high specificity and the like and are applicable to field detection.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and relates to a detection method for transgenic plants and their products, in particular to a primer set, a kit and a detection method for rapidly detecting the vip3A gene in transgenic plants using loop-mediated isothermal amplification technology (LAMP) . Background technique [0002] In 2014, the global planting area of ​​genetically modified crops reached 181.5 million hectares, an increase of more than 100 times compared with the initial commercialization in 1996. Currently commercially grown genetically modified crops mainly include soybean, corn, cotton, and rapeseed, and the main traits are resistance to insects and herbicides. Insect resistance genes derived from Bacillus thuringiensis (Bt) are currently the most widely used insect resistance genes in transgenic plants, including cry1Ab, cry1F, cry1Ie, cry1C, cry34Ab, cry35Ab, vip3A, etc., among which the vip3A gene has been ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6844
Inventor 李飞武夏蔚闫伟邵改革李葱葱董立明邢珍娟刘娜
Owner JILIN ACAD OF AGRI SCI