Genetically engineered bacteria co-producing butanol and 2,3-butanediol and its construction method and application

A technology of genetically engineered bacteria and construction methods, applied in the field of genetically engineered bacteria co-producing butanol and 2,3-butanediol and its construction, can solve the problem of no increase in the production of 3-hydroxybutanone, and achieve improved product quality. Value, increase economic efficiency, increase the effect of product yield

Active Publication Date: 2019-09-20
NANJING TECH UNIV
View PDF10 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, neither the expression of its own ALS (acetolactate synthase) nor the ALS of Bacillus subtilis in Clostridium acetobutylicum produced any increase in 3-hydroxybutanone production (Wardwell ll, S.A. Metabolism of acetoin in C. acetobutylicum ATCC824 .Rice University.1999)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetically engineered bacteria co-producing butanol and 2,3-butanediol and its construction method and application
  • Genetically engineered bacteria co-producing butanol and 2,3-butanediol and its construction method and application
  • Genetically engineered bacteria co-producing butanol and 2,3-butanediol and its construction method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1: Construction of Clostridium acetobutylicum containing expression plasmids of acetolactate decarboxylase genes CAC2967, BSU36000, BL02479, A3UG_05860, KPN2242-13255, EL23_18310 and CK00_RS0123920.

[0036] Table 1 Gene name and source of acetolactate decarboxylase

[0037] Acetolactate decarboxylase gene name source serial number CAC2967 C. acetobutylicum ATCC 824 SEQ ID NO: 1 BSU36000 B. Subtilis 168 SEQ ID NO: 2 BL02479 B. licheniformis ATCC14580 SEQ ID NO: 3 A3UG_05860 E. cloacae SDM SEQ ID NO: 4 KPN2242—13255 K. pneumoniae KCTC 2242 SEQ ID NO: 5 EL23_18310 P. polymyxa DSM 365 SEQ ID NO: 6 CK00_RS0123920 S. marcescens ATCC 14041 SEQ ID NO: 7

[0038] Genomic DNA of Clostridium acetobutylicum AT CC 824 in the middle and late stages of logarithmic growth was extracted with a bacterial genome kit, and its acetolactate decarboxylase gene CAC2967 was amplified by PCR with the followi...

Embodiment 2

[0056] Example 2: Construction of Clostridium acetobutylicum containing expression plasmids of acetoin reductase BSU06240, Cbei_1464, KPN_02061, CAETHG_0385.

[0057] Table 3 Acetoin reductase gene name and its source

[0058]

[0059] Bacillus subtilis B.Subtilis 168 and Clostridium beijerinckii (Clostridium beijerinckii) NCIMB 8052 were extracted by bacterial genome kit. The acetoin reductase genes BSU06240 and Cbei_1464 were amplified by PCR with the following primers:

[0060] BSU06240-s (SEQ ID NO: 16): AAAAGGGAGTGTCGA CATATG AAGGCAGCAAGATG (the underlined part is the NdeI recognition site);

[0061] BSU06240-as (SEQ ID NO: 17): GTACTGAGAGTGCAC CATATG TTAGTTAGGTACAAGGA (the underlined part is the NdeI recognition site). The amplified product was constructed according to the one-step cloning method in Example 1 to obtain vector pIMP1-BSU06240. After sequencing, its sequence is determined as shown in SEQ ID No:8.

[0062] Cbei_1464-s (SEQ ID NO: 18): AAAAGGGAGTGT...

Embodiment 3

[0068] Example 3: Construction of Clostridium acetobutylicum containing expression plasmids linking acetolactate decarboxylase gene BSU36000 and acetoin reductase BSU06240, Cbei_1464, KPN_02061, CAETHG_0385 respectively. In the above four gene sequences, the stop codon of the acetolactate decarboxylase gene BSU36000 was immediately followed by the start codon of the acetoin reductase BSU06240, Cbei_1464, KPN_02061, and CAETHG_0385.

[0069] Carry out PCR amplification with following primers and can make the gene fragment that acetolactate decarboxylase gene BSU36000 and acetoin reductase gene BSU06240, Cbei_1464, KPN_02061 and CAETHG_0385 connect:

[0070] BSU36000BSU06240-s (SEQ ID NO: 20): AAAAGGGAGTGTCGA CATATG AAACGAGAAAGCAACATTC (the underlined part is the NdeI recognition site);

[0071] BSU36000BSU06240-as (SEQ ID NO: 21): TGCCATCTTGCTGCCTTCATTTATTCAGGGCTTCCTTCAG;

[0072] BSU06240-s (SEQ ID NO: 22): CTGAAGGAAGCCCTGAATAAATGAAGGCAGCAAGATG;

[0073] BSU06240-as (SEQ I...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
viscosityaaaaaaaaaa
boiling pointaaaaaaaaaa
freezing pointaaaaaaaaaa
Login to View More

Abstract

The invention discloses a genetically engineered bacterium for co-generating butanol and 2,3-butanediol. The genetically engineered bacterium is a butanol generating clostridium to which an acetoin reductase gene is introduced or a butanol generating clostridium to which an acetolactic acid decarboxylase gene and the acetoin reductase gene are introduced. The nucleotide sequence of the acetolactic acid decarboxylase gene is any one of nucleotide sequences shown in SEQ ID NO:1-7, and the nucleotide sequence of the acetoin reductase gene is any one of nucleotide sequences shown in SEQ ID NO:8-11. An acetolactic acid decarboxylic reaction is enhanced in a clostridium acetobutylicum, the yield of 3-hydroxy butanone is greatly increased to about 6.4 g / L from initial about 1.8 g / L, and then acetoin is converted into 2,3-butanediol reaching up to 8.05 g / L under the effect of acetoin reductase; acetone is reduced to 2.2 g / L from about 4.5 g / L, and economic benefits of fermentation of the clostridium acetobutylicum are remarkably increased.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a genetically engineered bacterium for co-producing butanol and 2,3-butanediol, a construction method and application thereof. Background technique [0002] 2,3-Butanediol is a colorless, odorless liquid with strong hygroscopicity. It is liquid at room temperature, viscosity is 30.6mPa·s, boiling point is 178-182°C, freezing point is -60°C, miscible with water, soluble in ether and ethanol, and used as monomer in polymer synthesis. 2,3-Butanediol is an important bio-based four-carbon platform compound, which is widely used in food, chemical industry, aerospace fuel and other fields. [0003] The production methods of 2,3-butanediol mainly include chemical synthesis method and microbial fermentation method. The chemical synthesis method uses fossil raw materials to produce 2,3-butanediol with high cost, harsh conditions and cumbersome process, which is eas...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N1/21C12N15/74C12P7/16C12P7/18C12R1/145
CPCC12N9/0006C12N9/88C12P7/16C12P7/18C12Y101/01005C12Y401/01005Y02E50/10Y02T50/678
Inventor应汉杰沈晓宁柳东王岩岩许佳慧刘俊郭亭
OwnerNANJING TECH UNIV