Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Phomopsis RPB2 gene amplification primer and design method and application thereof

A technology for P. phomitus and gene amplification, which is applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., and can solve problems such as single-copy evolution rate

Inactive Publication Date: 2016-05-11
ANIMAL & PLANT & FOOD INSPECTION CENT OF TIANJIN ENTRY EXIT INSPECTION & QUARANTINE BUREAU
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

RPB2 (the secondlar-gest RNA polymerase subunit) gene is responsible for encoding the second largest subunit of RNA polymerase II, which has the characteristics of single copy and slow evolution rate

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Phomopsis RPB2 gene amplification primer and design method and application thereof
  • Phomopsis RPB2 gene amplification primer and design method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0017] Login to GenBank to search 60 species of Phomopsis RPB2 genes that have been sequenced so far, remove incomplete and partial sequences, find conserved sequences, and add sequencing sequences at the 5' end to obtain a pair of universal primers: its upstream primer PR2- F has 44 bases: CGCCAGGGTTTTCCCAGTCACGACATGGCCTACATGAAGCGATG, and the downstream primer PR2-R has 46 bases: AGCGGATAACAATTTCACACAGGAATCTCACAATGCGTGTACATGT.

[0018] The general primer PCR reaction system and reaction conditions that can amplify the Phomopsis fungus RPB2 gene are as follows:

[0019] The PCR reaction system is 25μL, containing 2×TaqMasterMix, 10μM primer PR2-F and primer PR2-R, DNA template solution containing 50-150ng, ddH2O. The reaction system is: 2×TaqMasterMix 12.5 μL, PR2-F 1 μL, PR2-R 1 μL, Template 1 μL, ddH2O 9.5 μL. The amplification conditions were: pre-denaturation at 94°C for 3 minutes, followed by denaturation at 94°C for 30s, annealing at 56°C for 30s, extension at 72°C for ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a phomopsis RPB2 gene amplification primer and a design method and application thereof. The phomopsis RPB2 gene amplification primer is a universal primer aiming at phomopsis fungi. The upstream primer PR2-F of the phomopsis RPB2 gene amplification primer has 44 bases, to be more specific, CGCCAGGGTTTTCCCAGTCACGACATGGCCTACATGAAGCGATG, and the downstream primer PR2-R of the phomopsis RPB2 gene amplification primer has 46 bases, to be more specific, AGCGGATAACAATTTCACACAGGAATCTCACAATGCGTGTACATGT. The phomopsis RPB2 gene amplification primer has the advantages that the primer is high in universality to phomopsis, high in amplification sequencing success rate, appropriate in fragment length and convenient in high-throughput sequencing and analysis, and an important tool is provided for the molecular ecology researches and quarantine and identification of the phomopsis.

Description

technical field [0001] The present invention designs Phomopsis fungus identification technical field, specifically, relates to Phomopsis RPB2 gene amplification primer and its design method and application. Background technique [0002] Phomopsis (Sacc.) Bubak is an important fungal genus in Deuteromycotina, Coelomycetes, Sphaeropsidales, Sphaeropsidaceae , and its behavior is Mesotopia ( Diaporthe ). More than 900 species of this genus of fungi have been described and are distributed worldwide, mainly in tropical and subtropical regions. Phomopsis is an important pathogenic fungus in agriculture and forestry. In the list of imported plant quarantine pests issued by my country in 2007, there are 6 species of quarantine Phomopsis and its morphological fungi, namely cucumber black root rot ( Phomopsis clerotioides ), sunflower stem canker ( Diaporthehelianthi ), apple fruit rot ( Diaportheperniciosa ), Soybean northern stem canker ( Diaporthephase olorum Sacc.var. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/11C12Q1/68
Inventor 胡佳续刘鹏郭京泽王金成廖芳罗加凤张莹黄国明
Owner ANIMAL & PLANT & FOOD INSPECTION CENT OF TIANJIN ENTRY EXIT INSPECTION & QUARANTINE BUREAU
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com