Phomopsis RPB2 gene amplification primer and design method and application thereof
A technology for P. phomitus and gene amplification, which is applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., and can solve problems such as single-copy evolution rate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0017] Login to GenBank to search 60 species of Phomopsis RPB2 genes that have been sequenced so far, remove incomplete and partial sequences, find conserved sequences, and add sequencing sequences at the 5' end to obtain a pair of universal primers: its upstream primer PR2- F has 44 bases: CGCCAGGGTTTTCCCAGTCACGACATGGCCTACATGAAGCGATG, and the downstream primer PR2-R has 46 bases: AGCGGATAACAATTTCACACAGGAATCTCACAATGCGTGTACATGT.
[0018] The general primer PCR reaction system and reaction conditions that can amplify the Phomopsis fungus RPB2 gene are as follows:
[0019] The PCR reaction system is 25μL, containing 2×TaqMasterMix, 10μM primer PR2-F and primer PR2-R, DNA template solution containing 50-150ng, ddH2O. The reaction system is: 2×TaqMasterMix 12.5 μL, PR2-F 1 μL, PR2-R 1 μL, Template 1 μL, ddH2O 9.5 μL. The amplification conditions were: pre-denaturation at 94°C for 3 minutes, followed by denaturation at 94°C for 30s, annealing at 56°C for 30s, extension at 72°C for ...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com