Patents
Literature
PatSnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

62 results about "Phomopsis sp." patented technology

Thaumatin-like protein gene PpTLP from pyrus pyrifolia nakai with antifungal activity and application

The invention relates to a thaumatin-like protein gene PpTLP from pyrus pyrifolia nakai with antifungal activity and application. The gene PpTLP has the base sequence shown in SEQID and coded thaumatin-like proteins. The invention verifies that the gene PpTLP has the function of improving the antifungal ability of the plants through correlation technique of functional genomics. When the antifungal gene PpTLP is constructed on a plant expression vector and is transformed into tobacco to be overexpressed, the transgenic tobacco has high antifungal activity. The protein from the transgenic tobacco expressing PpTLP has obvious inhibitory effects on various fungi such as sclerotinia sclerotiorum, phytophthora parasitica var. nicotianae, phomopsis sp. and the like.
Owner:KUNMING UNIV OF SCI & TECH

Endophytic fungus Phomopsis sp. and use thereof

The invention discloses an endophytic fungus Phomopsis sp. strain ZJWCF252, which was collected with a name of Phomopsiswenchengensis and a collection number of CGMCCNo.4301 in China General Microbiological Culture Collection Center of Institute of Microbiology of Chinese Academy of Sciences, which is located in building No.3, Yard No.1, Beichen Road, Chaoyang District, Beijing, on November 1st, 2010. The invention also discloses the use of the endophytic fungus Phomopsis sp. in the preparation of 2,3-dihydro-2-hydroxy-2,4-dimethyl-5-trans-propenylfuran-3-one which has strong inhibition effects on various plant pathogenic fungi.
Owner:ZHEJIANG DAYANG BIOTECH GROUP

Streptomycete for producing volatile antibacterial substances and application thereof

The invention provides streptomycete for producing volatile antibacterial substances and application thereof. The streptomycete is named as Streptomycesmicionensis TF78; the streptomycete was collected to Guangdong Microbiological Culture Collection Center on October 25th, 2017, and the collection number is GDMCC NO:60254. The streptomycete has the inhibiting functions on the pathogenic bacteria of cucumber blight, tomato gray mold, teak canker, banana fungal stem rot, rice blast fungi, mango phomopsis leaf spot, mango pestalotiopsis leaf spot, mango botryosphaeria branch blight, mango anthracnose and the like.
Owner:GUANGXI ZHUANG AUTONOMOUS REGION ACAD OF AGRI SCI

Phomopsis sp. strain and application thereof in performing biotransformation on celastrol

ActiveCN109957515ANo significant difference in antibacterial activityLow cytotoxicityAntibacterial agentsOrganic active ingredientsCelastrolCytotoxicity
The invention discloses a phomopsis sp. strain and an application thereof in performing biotransformation on celastrol. The phomopsis sp. strain provided by the invention is phomopsis sp. LGT-5, and the preservation registration number is CGMCC No.16088. The application of the phomopsis sp. LGT-5 in a compound of a preparation formula (III) is protected. The phomopsis sp. LGT-5 can transform the celastrol into a new compound 16-OH-Celastrol. Compared with the celastrol, the 16-OH-Celastrol has no significant difference in antibacterial activity, but the cytotoxicity is greatly reduced, and the16-OH-Celastrol can be used as a new bacteriostatic drug.
Owner:NINGXIA MEDICAL UNIV

Quick induced spore production method and application of Phomopsis

ActiveCN105176847AProduce quicklyQuick and easy sporulationFungiSporeSnow mold
The invention discloses a quick induced spore production method and application of Phomopsis, belonging to the field of phytopathogen induced spore production. According to the method, Phomopsis mycelia cultured by a PDA (potato dextrose agar) solid culture medium, which is used as a spore production base, is subjected to lawn brooming, sterilized water flushing, drying and constant-temperature lighting culture to induce the mycelia to quickly produce abundant conidiomata within 4 days. Nine different strains of Phomopsis are respectively utilized to quickly produce spores in the mycelia in the dryly-stored activated state. When being used for quick simple induced spore production of Phomopsis, the method can greatly enhance the spore production efficiency, shortens the identification period, effectively saves the human and material resources and the abundant precious time of researchers, and thus, has great application potential and higher economic value.
Owner:WUHAN BOTANICAL GARDEN CHINESE ACAD OF SCI

Method for promoting accumulation of triterpene in betula platyphylla suk. suspension cell by utilizing endophytic fungi elicitor

The invention provides a method for promoting accumulation of triterpene in betula platyphylla suk. Suspension cell by utilizing endophytic fungi elicitor. The method utilizes endophytic fungi separated from betula latyphylla suk. bark, the endophytic fungi is prepared into fungi elicitor, appropriate concentration of fungi elicitor is added in appropriate stage of betula platyphylla suk. suspension cell growth, after induction is carried out for a period of time, cells are collected, and endophytic fungi capable of effectively improving accumulation of triterpene is screened out as phomopsis sp. On the basis, induction effect of polysaccharide elicitor and protein elicitor prepared by the fungi is further optimized; 40Mug / ml of polysaccharide elicitor is added on the eighth day of betula platyphylla suk. cell culture, triterpene content in cell after induction for one day reaches up to 29.47mg / g, being 1.78 times that of the control group; 80Mug / ml of fungus protein elicitor is added on the eighth day of betula platyphylla suk. cell culture, induction culture is carried out for four days, and triterpene content in cell reaches up to 34.49mg / g, being 2.47 times that of the control group. In the invention, the type and concentration of the added elicitor, growth stage of betula platyphylla suk. suspension cell added with appropriate elicitor and induction time of elicitor are determined, induction technology of effectively improving accumulation of triterpene in betula platyphylla suk. suspension cell is formed, and important theory and technical basis are laid for betula platyphylla suk. triterpene production by utilizing cell engineering technology, thus the invention has wide application potential and promotion prospect.
Owner:NORTHEAST FORESTRY UNIVERSITY +2

Screening of new strain capable of producing camptothecin and method for preparing camptothecin

The invention discloses a new strain capable of producing camptothecin and a method for preparing camptothecin by using the same. The new strain capable of producing the camptothecin-Phomopsis sp. B29 is conserved in China General Microbiological Culture Collection Center (CGMCC) on July 14, 2010, and has a conservation number of CGMCC No. 3988. The camptothecin is indole alkaloid with antitumor activity and is extracted from Camptotheca acuminate-nyssaceae plant of China, and the camptothecin has good curative effect on malignant tumors such as colon cancer, ovarian cancer and the like. Direct extraction of the camptothecin from the Camptotheca acuminate causes vegetation deterioration, ecological unbalance and other problems, and a chemical synthesis method has the disadvantages of long route, low yield and high cost; and aiming at the problems, endophytic fungi are separated and purified from the bark and fruit of the Camptotheca acuminate, and the strain capable of producing the camptothecin is screened from the endophytic fungi and then is used for preparing the camptothecin through fermentation. The new strain provided by the invention can be taken as a new medicine source for producing the camptothecin; and the method for preparing the camptothecin by fermenting the new strain is convenient to operate and has the advantage of low cost.
Owner:INST OF PROCESS ENG CHINESE ACAD OF SCI

Method for improving alkaloid content of dendrobium huoshanense protocorm

The invention provides a method for improving the alkaloid content of dendrobium huoshanense protocorm, wherein dendrobium huoshanense protocorm is used as a material, and the alkaloid content of the dendrobium huoshanense protocorm is increased by using a Phomopsis elicitor. According to the present invention, the influence of the Phomopsis elicitor on the alkaloid content of the dendrobium huoshanense protocorm during suspension culture is researched, and the purpose of the present invention is to provide the new idea for the large-scale industrial production of alkaloids and other medicinal components from dendrobium huoshanense, and the theoretical basis for the medicine source development of dendrobium huoshanense.
Owner:FUJIAN AGRI & FORESTRY UNIV

Phomopsis RNA (ribonucleic acid) polymerase (RPB1) gene amplification primer, as well as design method and application thereof

The invention discloses a phomopsis RNA polymerase (RPB1) gene amplification primer, as well as a design method and application thereof. The primer is designed to aim at a universal primer of phomopsis funguses. An upstream primer PhR1-F has 43 basic groups: CGCCAGGGTTTTCCCAGTCACGACTGCAGCAAGGTGTTGGCTG, and a downstream primer PhR1-R has 43 basic groups: AGCGGATAACAATTTCACACAGGAGCGATGTCGTTGTCCATGTA. The primer can rapidly perform large-scaled genetic background analysis on the phomopsis funguses, and provides an important tool for species identification, geographical population identification or inspection and quarantine works of phomopsis in the country of China.
Owner:ANIMAL & PLANT & FOOD INSPECTION CENT OF TIANJIN ENTRY EXIT INSPECTION & QUARANTINE BUREAU

Trichoderma asperellum TZ312, application thereof, volatile metabolite thereof and application of volatile metabolite

ActiveCN111893046AGrowth inhibitionReduced incidence of Fusarium wiltBiocideFungiColletotrichum gossypiiTrichoderma asperellum
The invention provides trichoderma asperellum TZ312, application thereof, a volatile metabolite thereof and application of the volatile metabolite, and relates to the technical field of microorganisms. The trichoderma asperellum TZ312 is preserved in Guangdong Microbiological Culture Collection Center and has a preservation number of GDMCC NO:60253. The trichoderma asperellum TZ312 is capable of completely inhibiting and covering growth of hyphae of banana wilt disease germs on a panel; and the trichoderma asperellum TZ312 is capable of obviously decreasing the occurrence rate of a banana wiltdisease in a greenhouse pot experiment, and the prevention effect is 65% or above. The trichoderma asperellum TZ312 is further capable of inhibiting fusarium oxysporum f.sp.cucumerinum, botrytis cinerea, botrytis cinerea, fusarium solani, fusarium proliferatum, magnaporthe oryzae, phomopsis sp., pestalotiopsis sp., botryosphaeria dothidea or colletotrichum gloeosporioides and is wide in antibacterial spectrum. The volatile metabolite of the trichoderma asperellum TZ312 can be used for inhibiting preservation diseases.
Owner:INST OF PLANT PROTECTION GUANGXI ACADEMY OF AGRI SCI

Mycorrhiza helper bacterium Bacillus spp and its application in populus growth promotion

The invention discloses a mycorrhiza helper bacterium Bacillus spp and its application in populus growth promotion. The above mycorrhiza helper bacterium is preserved in the China Center for Type Culture Collection in Wuhan University in Wuhan, China on April 6, 2013 as Bacillus spp. MY-DZ18, and has a preservation number of CCTCC NO:M2013125. The Bacillus spp. MY-DZ18 is a mycorrhiza helper bacterium, can promote the mycelia growth of two ectomycorrhizal fungi comprising Pisolithus tinctorius and Lactarius insulsus; pot experiment results show that the respective double inoculation of the MY-DZ18 strain with the two ectomycorrhizal fungi substantially improves the mycorrhiza formation rate of the root of the populus, and promotes the growth of the populus; and the MY-DZ18 strain has an antagonistic effect on Botryosphaeria dothidea Phomopsis sp., Cytospora chrysosperma and seedling damping-off pathogen Fusarium oxysporum.
Owner:NANJING FORESTRY UNIV

A Phomopsis strain and its application in the biotransformation of tripterine

ActiveCN109957515BNo significant difference in antibacterial activityLow cytotoxicityAntibacterial agentsBiocideBiotechnologyAntibiosis
The invention discloses a Phomopsis strain and its application in the biotransformation of tripterine. The Phomopsis sp. strain provided by the present invention is Phomopsis sp. LGT‑5, and the preservation registration number is CGMCC No.16088. The present invention also protects the application of Phomopsis LGT‑5 in the preparation of the compound represented by formula (III). Phomopsis LGT‑5 can convert tripterine into a new compound 16‑OH‑Celastrol. Compared with tripterine, 16‑OH‑Celastrol has no significant difference in antibacterial activity, but its cytotoxicity is greatly reduced, and it can be used as a new type of antibacterial drug.
Owner:NINGXIA MEDICAL UNIV

Novel phomopsis fungus strain, preparation method and application

The invention provides a novel phomopsis fungus strain and belongs to the technical field of microorganisms. The novel phomopsis fungus strain is preserved in the China Center for Type Culture Collection (CCTCC) with the preservation number of CCTCC NO. M 2020394. The novel phomopsis strain has broad-spectrum antibacterial activity and antioxidation activity and can be applied to preparation of agricultural or medical microbial antibacterial agents and antioxidants. The invention further provides a preparation method and application of the novel phomopsis fungus strain.
Owner:YUNNAN UNIV

Penicillium oxalicum capable of degrading 2-phenethyl alcohol produced from rice straw and application thereof

The invention provides penicillium oxalicum capable of degrading 2-phenethyl alcohol produced from rice straw and application thereof. The penicillium oxalicum is penicillium oxalicum T1, and was preserved in the China Center for Type Culture Collection. The preservation number is CCTCC M 2019608. The penicillium oxalicum T1 provided by the invention has good cellulose degradation ability, can produce cellulase, and has strong endoglucosidase activity, filter paper enzyme activity, exonuclease activity and beta-glucosidase activity; and the penicillium oxalate T1 can degrade 2-phenethyl alcohol produced by degradation of rice straw. The fermentation broth that degrades rice straw can inhibit Phomopsis sp., Magnaporthe grisea and Fusarium oxysporum.
Owner:INST OF MICROBIOLOGY JIANGXI ACADEMY OF SCI

Streptomyces with dual functions of disease prevention and insecticide, application thereof, cultivation method, and biocontrol agent

ActiveCN110029078BGrowth inhibitionBiocideBacteriaColletotrichum gossypiiCotton bollworm
The invention relates to a streptomycete with dual functions of disease prevention and insecticide, its application, a cultivation method and a biocontrol agent, and belongs to the technical field of plant disease and insect pest control. In the present invention, an endophytic streptomyces MS001 with antibacterial activity is isolated; Botrytis cinerea, wheat scab, clivia stem rot, and nandina anthracnose all have strong antibacterial activity, and the antibacterial objects have a broad spectrum; and other plant pests. Therefore, Streptomyces MS001 can prevent and control some diseases and pests on apple trees, garden plants, vegetables, and food crops.
Owner:HENAN UNIV OF SCI & TECH

Phomopsis fungus strain E41 and applications thereof

The invention belongs to the technical field of pesticide degradation by endophytic bacteria, and specifically relates to a phomopsis fungus strain E41 and an application thereof in herbicide chipton degradation. The taxonomic name of the phomopsis fungus strain E41 is Phomopsis sp. E41. The phomopsis fungus strain E41 is preserved in Guangdong Culture Collection Center (GDMCC) in January 16th, 2017. The preservation number is GDMCC No.60143. The provided phomopsis sp. E41 can degrade herbicide chipton in water or soil, the cost is low, the industrialization is easy, the market prospect is good, and at the same time, the industrial application value is great.
Owner:GUANGXI UNIV

Bacillus subtilis for inhibiting phomopsis and application thereof

The invention provides a bacillus subtilis for inhibiting phomopsis which is bacillus subtilis T8 deposited in China Center for Type Culture Collection on December 5, 2018 with the preservation numberof CCTCC NO: M 2018860. The bacillus subtilis T8 has good cellulose degradation capability, can produce cellulase, and has strong endoglucanase activity, filter paper enzymatic activity, exonucleaseactivity and beta-glucosidase activity. The bacillus subtilis T8 can inhibit phomopsis, and an ethanol supernatant and a protein have inhibitory effects on the phomopsis. In addition, the bacillus subtilis T8 can inhibit the growth of escherichia coli, staphylococcus aureus, candida albicans, shigella dysenteriae and enterobacter faecalis, and has a development and utilization value in inhibitinghuman pathogenic bacteria. The invention also provides application of the bacillus subtilis T8 in producing cellulase and preventing kiwi fruit soft rot.
Owner:INST OF MICROBIOLOGY JIANGXI ACADEMY OF SCI

Phomopsis rhzomorph compound and its preparation method and application

A phomopsis compound, a relative preparation method and an application relate two compounds. The invention provides a phomopsis compound of sea weed fungus with strong antibacterial activity and application in antibacterial drugs, a relative preparation method and an application, wherein the sea weed fungus is hzla01-1(Phomopsis sp.hzla01-1) as phomopsis compound A and B, compound A is colorless oily substance, and the compound B is colorless acicular crystal. The preparation method comprises seed cultivation of phomopsis hzla01-1, fermentation of phomopsis hzla01-1, extraction of phomopsis compound and refining phomopsis compound. Pharmacological verification proves that the compound has significant antibacterial function and can be used to prepare new antibacterial drug.
Owner:XIAMEN UNIV

Phomopsis sp. fungus strain and application to fungus-line wood preparation thereof

The invention discloses a phomopsis sp. fungus strain of J9GAN and an application to fungus-line wood preparation thereof, and belongs to the field of microbial technology. The strain is preserved at China general microbiological culture collection center at No. 3, Courtyard 1, Beichen West Road, Chaoyang district, Beijing, and has a preservation number of CGMCC No: 7108. The strain has excellent dip dyeing capability for wood substrates; the dip dyeing time is short and the dip dyeing depth is great; beautiful color and texture can be formed on substrate surfaces; and the physical mechanical strength is not influenced. The method for preparing fungus-line wood by using the strain comprises the steps of strain activation, amplification and propagation, and inoculation and culture. Firstly, the strain is inoculated on an activation, amplification and propagation culture medium; activation, amplification and propagation are carried out at 22-30 DEG C for 7-15 days; then a wood substrate is disinfected, and fully contacted with the amplified and propagated strains; and culture is carried out at 22-30 DEG C for 4-8 weeks. The method of the invention is reasonable in process, and easy to operate; the prepared fungus-line wood has very good decorative effect, has no influence on physical mechanical properties of the substrate, and is suitable for large-scale production, popularization and application.
Owner:SOUTHWEST FORESTRY UNIVERSITY

Endophytic fungus strain for efficient biotransformation of betulinic acid and application of endophytic fungus strain

ActiveCN110527632AEfficient biotransformation abilityExcellent strain materialOrganic active ingredientsFungiMicrobiologyBacterial strain
The invention discloses an endophytic fungus strain for efficient biotransformation of betulinic acid and application of the endophytic fungus strain. The invention firstly provides a Phomopsis sp. WDS2 strain, and the preservation number of the Phomopsis sp. WDS2 in China Center for Type Culture Collection is CCTCC NO: M 20199394. The invention further provides a microbial inoculum containing thePhomopsis sp. WDS2 and application of the microbial inoculum. The Phomopsis sp. WDS2 disclosed by the invention has the capability of efficiently and biologically converting betulin into betulinic acid; the betulinic acid conversion amount reaches 23.5 mg / L, so that the Phomopsis sp. WDS2 provides an excellent bacterial strain material for the development of anticancer and antiviral products in the future, and has an important value.
Owner:NORTHEAST FORESTRY UNIVERSITY

A kind of plant root rot biocontrol bacteria and application thereof

ActiveCN111996130BReduce disease severityIncrease productionBiocideFungiBiotechnologyPlant roots
The invention discloses a plant root rot biocontrol bacterium and its application. The biocontrol bacterium is named Pythium oligandrum Pyo34-3, and the depository unit is: General Microbiology Center of China Microbiological Culture Collection Management Committee, and the preservation number is CGMCC NO.20224; applications include the application in the control of plant root rot caused by Phytophthora soybean, Pythium ultima, Fusarium oxysporum and Phomopsis etc. The invention provides a beneficial microorganism capable of effectively preventing and controlling plant root rot and application thereof.
Owner:瀚星生物科技(南京)有限公司

Preparation method of compound and its application

The invention provides a preparation method of the compound 1, 13-dihydroxy-6-methyl-6, 7, 8, 9, 12, 13, 14, 14a-octyl hydrogen-1H-cyclopentane [f][1] epoxytridecane-4(11aH)-one and its application. The compound is obtained by solid fermentation and extraction separation of a production strain, which is wintersweet Phomopsis chimonanthi that is preserved in China general microbiological culture collection center on December 5, 2011, with a preservation number of CGMCC No 5551. The compound prepared in the invention has inhibiting activity on Aspergillus fumigatus.
Owner:BIOTECH CENT OF SHANDONG ACAD OF SCI

CRISPR/Cas9 vector suitable for phomopsis sp. FS508 as well as construction method and application of CRISPR/Cas9 vector

The invention discloses a CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) / Cas9 vector suitable for phomopsis sp. FS508 and a construction method and application of the CRISPR / Cas9 vector. According to the invention, the CRISPR / Cas9 technology is used for the first time to construct a recombinant P.lithocarpus FS508 strain with knocked-out polyketone new skeleton compound lithocarpins biosynthetic genes, and a CRISPR / Cas9 gene knockout system suitable for deep sea fungi P.lithocarpus FS508 is established,therefore, the molecular biology foundation is laid for the elucidationof the biosynthesis mechanism of the lithocarpins in the P. lithocarpus FS508 and the acquisition of more lithocarpins polyketone derivatives with remarkable anti-tumor activity.
Owner:GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY

Compound, preparation method and application thereof

The invention discloses a compound with the following structural formula as shown in the specification, and further provides a method of preparing the compound through fermenting and culturing a bacterial strain CGMCC No. 5416 of Phomopsis sp. The compound has good antineoplastic activities for human non-small-cell lung cancer cells, human breast cancer cells, human pancreas cancer cells, human metastasis pancreatic adenocarcinoma cells, human in situ pancreatic adenocarcinoma cells and many other tumor cells, and can be used for preparation of antitumor drugs.
Owner:SHANGHAI LAIYI BIOMEDICAL RES & DEV CENT

Rapid detection method and application of phomopsis nicotianae

The invention provides a rapid detection method for phomopsis nicotianae and application of the rapid detection method. The rapid detection method for the phomopsis nicotianae comprises the following steps of extracting genome DNA (Deoxyribose Nucleic Acid); designing a specific primer; detecting the specific primer; and detecting the sensitivity of the specific primer. According to the rapid detection method for the phomopsis nicotianae, the molecular information of the phomopsis nicotianae fungi can be rapidly, specifically and sensitively detected, and only one PCR reaction is carried out on genomic DNA of pathogenic bacteria as low as 10 pg; the method overcomes the defect that in the prior art, the time needed for morphological analysis and confirmation is too long only through strain isolated culture, disease control delay caused by the fact that symptoms are not easy to distinguish is avoided, meanwhile, pathogenic bacteria can be accurately detected in time according to the existence of trace pathogenic bacteria, disease control and early warning are facilitated, and meanwhile, a scientific basis is provided for further research of phomopsis.
Owner:HENAN AGRICULTURAL UNIVERSITY

Pseudomonas protegens inhibiting phomopsis and application of pseudomonas protegens

ActiveCN110004087APromote degradationStrong endoglucosidase activityBiocideBacteriaStaphylococcus aureusActinia
The invention provides pseudomonas protegens inhibiting phomopsis. The pseudomonas protegens is pseudomonas protegens 13, and is preserved in the Chinese typical culture preservation center on December 5, 2018, wherein the preservation number is CCTCC NO: M 2018861. The pseudomonas protegens 13 has a good cellulose degradation ability, can produce cellulase, has stronger incision glucosidase activity, filter paper enzyme activity, excision enzyme activity and beta-glucosidase activity, and has application value in the production of the cellulase. The pseudomonas protegens 13 can inhibit the phomopsis. In addition, the pseudomonas protegens 13 can inhibit the growth of escherichia coli, staphylococcus aureus, candida albicans, shigella dysenteriae and enterobacter faecalis, and has development and utilization value in inhibiting human pathogenic bacteria. The invention also provides the application of the pseudomonas protegens 13 in producing cellulase and controlling kiwi soft rot.
Owner:INST OF MICROBIOLOGY JIANGXI ACADEMY OF SCI

Phomopsis RPB2 gene amplification primer and design method and application thereof

The invention discloses a phomopsis RPB2 gene amplification primer and a design method and application thereof. The phomopsis RPB2 gene amplification primer is a universal primer aiming at phomopsis fungi. The upstream primer PR2-F of the phomopsis RPB2 gene amplification primer has 44 bases, to be more specific, CGCCAGGGTTTTCCCAGTCACGACATGGCCTACATGAAGCGATG, and the downstream primer PR2-R of the phomopsis RPB2 gene amplification primer has 46 bases, to be more specific, AGCGGATAACAATTTCACACAGGAATCTCACAATGCGTGTACATGT. The phomopsis RPB2 gene amplification primer has the advantages that the primer is high in universality to phomopsis, high in amplification sequencing success rate, appropriate in fragment length and convenient in high-throughput sequencing and analysis, and an important tool is provided for the molecular ecology researches and quarantine and identification of the phomopsis.
Owner:ANIMAL & PLANT & FOOD INSPECTION CENT OF TIANJIN ENTRY EXIT INSPECTION & QUARANTINE BUREAU

Tripterine derivative and application thereof in tumor resistance

ActiveCN114395010AHas antitumor activityNo significant difference in antitumor activityOrganic active ingredientsSteroidsPhomopsis sp.Microbiological culture
The invention provides a tripterine derivative which is obtained by carrying out biotransformation and separation on tripterine by adopting phomopsis (the preservation registration number is CGMCC (China General Microbiological Culture Collection Center) NO.16088). Compared with the tripterine, the antitumor activity of the tripterine derivative has no significant difference, but the cytotoxicity is greatly reduced. The tripterine derivative disclosed by the invention has the potential of being prepared into a novel anti-tumor drug, and a wide application prospect is provided for preparing the tripterine derivative by utilizing a biotechnology on a large scale.
Owner:NINGXIA MEDICAL UNIV

Plant root rot biocontrol bacterium and application thereof

ActiveCN111996130AReduce disease severityIncrease productionBiocideFungiBiotechnologyPlant roots
The invention discloses a plant root rot biocontrol bacterium and an application thereof. The biocontrol bacterium is named pythium oligandrum Pyo34-3, the preservation unit is China General Microbiological Culture Collection Center, and the preservation number is CGMCC NO.20224. The application comprises application in prevention and treatment of plant root rot caused by phytophthora sojae, pythium ultimate, fusarium oxysporum, phomopsis and the like. The invention provides a beneficial microorganism capable of effectively preventing and treating plant root rot and an application thereof.
Owner:瀚星生物科技(南京)有限公司

A kind of bacteriostasis method of camphor leaf essential oil

The invention discloses a bacteriostasis method of camphor leaf essential oil. The essential oil is extracted by steam distillation or simultaneous distillation and extraction, the distilled liquid is separated from oil and water, and the oil part is dried with anhydrous sodium sulfate to obtain the camphor leaf essential oil. , and the obtained camphor leaf essential oil is used as an active ingredient to inhibit phytopathogenic fungi. When the volume ratio of camphor leaf essential oil is 7:25, the antibacterial rates against Fusarium oxysporum, Thielavia aescini and Phomopsis are not less than 80%, 90% and 61% respectively.
Owner:JINGGANGSHAN UNIVERSITY