Method for improving rice yield through OsGRF6 gene, and applications thereof

A rice and gene technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve problems such as no research reports, and achieve the effect of huge application potential.

Active Publication Date: 2016-06-08
WUHAN UNIV
View PDF4 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, its function in monocots is still in the exploration stage, and there is no research report on improving rice yield.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for improving rice yield through OsGRF6 gene, and applications thereof
  • Method for improving rice yield through OsGRF6 gene, and applications thereof
  • Method for improving rice yield through OsGRF6 gene, and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] 1. Obtaining the full-length fragment of the GRF6 gene

[0045]Using KOME full-length cDNA clone (AK073578) as a template (purchased from GenomeResource Center, National Institute of Agrobiological Science, Japan), design primer pair G6F / G6R and add attB recombination site (Invitrogen) at the respective 5' ends. The primer sequences are shown in Table 2, and PCR amplification The obtained product is sequenced and analyzed, and the nucleotide sequence of the amplified gene fragment is shown in SEQ ID NO.4, and the structure diagram of the GRF6 gene is shown in figure 1 shown.

[0046] Table 2. Primer sequences

[0047] Primer name

Primer sequence (5'-3')

G6F

ATGCAGGGTGCAATGGCCAGGGTGA

G6R

TCACACCAGGCGGATGCTCGGATG

[0048] 2. Construction of GRF6 gene overexpression vector

[0049] The product amplified with the primer pair G6F / G6R was inserted into the expression vector pH7WG2D through BP and LR two-step reaction (Invitrogen) t...

Embodiment 2

[0062] 1. Obtaining the GRF6 gene interference fragment

[0063] Using the KOME full-length cDNA clone (AK073578) as a template (purchased from GenomeResource Center, Japan, National Institute of AgrobiologicalScience), design primer pair R6F / R6R and add attB recombination site (Invitrogen) at the respective 5' ends. The primer sequences are shown in Table 4, and PCR amplification The obtained product was subjected to sequencing analysis, and the nucleotide sequence of the amplified gene fragment was shown in SEQ ID NO.5.

[0064] Table 4. Primer sequences

[0065] Primer name

Primer sequence (5'-3')

R6F

TCCATTAGCACGAGAAA

R6R

AAAGAATCACGGAACATAG

[0066] 2. Construction of GRF6 gene interference vector

[0067] The product amplified with primer pair R6F / R6R was inserted into the expression vector pANIC8A (http: / / plantsciences.utk.edu / stewart_panic.htm; MannDGJetal., PlantBiotechJ10:226-236) through BP and LR two-step reaction (Invitr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses a method for improving the rice yield through OsGRF6 gene, and applications thereof, and belongs to the technical field of crop genetic engineering. According to the present invention, after the GRF6 gene is subjected to overexpression in rice, the secondary rachis branch number and the number of grains per ear of the rice are increased, and after the GRF6 gene is subjected to knocking-out, deactivation or activity reducing in rice, the secondary rachis branch number per ear and the number of grains per ear are significantly reduced, such that it is indicated that the gene can control the rice yield; the GRF6 gene is introduced into the rice through the expression vector to make the GRF6 be subjected to overexpression so as to increase the rice yield; the GRF6 gene can further be used as the molecular marker used in the crop breeding; and the GRF6 gene provides the powerful means and tool for the new high yield rice variety by using the molecular marker-assisted breeding and the genetic engineering method, and has great application potential.

Description

technical field [0001] The invention relates to the technical field of crop genetic engineering, in particular to a method for improving rice yield by OsGRF6 gene and its application. Background technique [0002] Rice yield includes traits such as effective panicle, number of grains per panicle, seed setting rate and thousand-grain weight. Increasing the number of grains per panicle is one of the key factors to increase rice yield, and the number of grains per panicle is usually positively correlated with the number of secondary branches. Therefore, identification, cloning and regulation of genes related to secondary branch differentiation can increase rice yield through genetic engineering and other methods, promote rice genetic improvement, and increase production efficiency. [0003] Although agricultural scientists have done a lot of research on the mechanism of rice panicle development and the cloning of related genes, the genes that regulate rice panicle development ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/29C12N15/82C12Q1/68C07K14/415A01H5/00
Inventor李绍清高峰朱英国
OwnerWUHAN UNIV