Check patentability & draft patents in minutes with Patsnap Eureka AI!

Rice cytoplasmic kinase gene osbhl1 and its encoded protein and application

A cytoplasmic, rice technology, applied in the field of plant genetic engineering, can solve the problem of little known leaf curling

Active Publication Date: 2018-10-26
WUHAN UNIV
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, little is known about the molecular mechanism of leaf curling

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rice cytoplasmic kinase gene osbhl1 and its encoded protein and application
  • Rice cytoplasmic kinase gene osbhl1 and its encoded protein and application
  • Rice cytoplasmic kinase gene osbhl1 and its encoded protein and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] [Example 1] Acquisition of rice OsBHL1 gene

[0049] A cytoplasmic kinase protein OsBHL1 was found by screening the interacting proteins of the lectin receptor protein kinase LecRK in the rice 9311 library, and the ORF sequence of the gene was amplified in the cDNA of indica rice B5 by designing primers, and compared with the Nipponbare sequence in the database Yes, only 3 nucleotide differences were found, which can be understood as the difference of the same gene in different rice varieties in the present invention, and then the gene sequence was obtained by amplifying primers designed by Nipponbare Sequence.

Embodiment 2

[0050] [Example 2] Rice OsBHL1 gene expression pattern

[0051] In order to understand the expression of the OsBHL1 gene, samples of H1493 (the transgenic receptor material used in the present invention) in different periods were used for tissue expression patterns, and as a result, the expression level of this gene was the highest at the flag leaf stage ( figure 1 ), so the follow-up sampling and detection generally use the flag leaf, on the one hand because the expression level is the highest in the flag leaf, and on the other hand because the traits of the flag leaf are relatively stable.

[0052] The primers used for quantitative PCR are:

[0053] BHL1Q-F: CCGGCAAGAACGGTGGACGA (5'-3') (SEQ ID NO.4)

[0054] BHL1Q-R: TGAGCAAGAAGATGGGGATG (5'-3') (SEQ ID NO.5)

Embodiment 3

[0055] [Example 3] OsBHL1 gene overexpression vector construction and genetic transformation mediated by Agrobacterium

[0056] 1. Construction of OsBHL1 overexpression vector

[0057] Cut off a section of designed primers at both ends of the ORF of OsBHL1, add the restriction site of Bgl II and the protection base, the sequence is as follows:

[0058] OEV-F: AGTCAGATCTATGAGGCCTCTGTACCTGC (5'-3') (SEQ ID NO. 6) OEV-R: AGTCAGATCTCTAATTGCTCAAAGATGATGAGC (5'-3') (SEQ ID NO. 7)

[0059] The vector used is pCXUN (provided by Professor Wang Guoliang of Ohio State University in the United States), and the pCXUN vector is digested with BglII, and the foreign fragment can be directly connected after adding A. According to the sequence of SEQ ID No.3, the PCR method was used to directly amplify the ORF, and after adding A, it was connected into the vector. After the sequence verification is correct, the obtained vector is the OsBHL1 gene overexpression vector, which is electrotransfor...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a rice cytoplasm kinase gene OsBHL1, and belongs to the technical field of plant genetic engineering. A nucleotide sequence of the rice cytoplasm kinase gene Os BHL1is shown as SEQ ID No.1, a cDNA sequence is shown as SEQ ID No.2, and a protein sequence is shown as SEQ ID No.3. The rice cytoplasm kinase gene Os BHL1 is transferred into a japonica rice variety Hokiang 19 (H1493) through agrobacterium tumefaciens mediated genetic transformation, and plant dysplasia and the resistance increasing effect happen to overexpressed plants and mainly represent crimping of plant leaves, increasing of erectness, reducing of tillering, reducing of the maturing rate, reducing of the thousand seed weight, increasing of the number of ears and enhancement of resistance to brown planthopper. The gene has a pleiotropy function, and has very good reference significance on study of gene molecule function and breeding work.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering, and specifically relates to a rice cytoplasmic kinase gene OsBHL1 and its encoded protein and application. Background technique [0002] Rice is an important food crop, and more than half of the world's people use it as a staple food. At the same time, rice is also a hot plant in agricultural production and scientific research. As a model plant for scientific research, after the completion of the rice genome project, its The study of functional genome has received more and more widespread attention, especially the study of some genes that regulate important agricultural traits of rice has been paid more and more attention by researchers. [0003] Receptor-like protein kinases play important roles in plant growth, development and defense responses. General receptor-like protein kinases include four structural domains: N-terminal signal peptide, extracellular receptor recognition, single t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/12C12N15/54C12N15/82A01H5/00A01H6/46C12Q1/6895
CPCC12N9/1205C12N15/8205C12N15/8286C12Q1/6895C12Y207/01037
Inventor 何光存马银花杜波陈荣智祝莉莉
Owner WUHAN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com