Unlock instant, AI-driven research and patent intelligence for your innovation.

Rice transcription factor gene OsMYBS1 as well as encoded protein and application thereof

A rice transcription factor and transgenic technology, applied in the rice transcription factor gene OsMYBS1 and its encoded protein and application fields, can solve problems such as loss of resistance

Pending Publication Date: 2020-09-22
HUNAN UNIV OF HUMANITIES SCI & TECH
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the migratory nature of N. lugens and different biotypes, rice varieties containing a single resistance gene will gradually lose their resistance after a few years of planting.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rice transcription factor gene OsMYBS1 as well as encoded protein and application thereof
  • Rice transcription factor gene OsMYBS1 as well as encoded protein and application thereof
  • Rice transcription factor gene OsMYBS1 as well as encoded protein and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] [Example 1] Acquisition of rice OsMYBS1 gene

[0064] A transcription factor OsMYBS1 protein was found by screening the interacting proteins of the lectin receptor protein kinase OsLecRK in the rice 9311 library, and the ORF sequence of the gene was amplified in the cDNA of the indica rice 9311 by designing primers, and compared with the Nipponbare sequence in the database Yes, it was found that only 12 nucleotides were missing, and it did not cause a frameshift mutation. In the present invention, it can be understood as the difference between different rice varieties of the same gene. Then, by referring to the Nipponbare sequence on the website, the ORF sequence at both ends The sequence obtained by intercepting a designed primer and amplifying the cDNA of indica rice 9311 is the 909 bp ORF sequence of the OsMYBS1 gene.

Embodiment 2

[0065] [Example 2] Rice OsMYBS1 Gene Tissue Expression Pattern

[0066] In order to understand the expression of the OsMYBS1 gene, samples of H1493 (the transgenic receptor material used in the present invention, from the laboratory of Professor He Guangcun, Wuhan University) were taken for tissue expression patterns at different periods, and the expression of this gene was the highest in the leaf sheath at the heading stage , followed by leaves at the second tillering stage and heading stage ( figure 1 ), because the flag leaves at the heading stage are relatively stable, and the relative expression level is relatively high, so the flag leaves are generally selected for subsequent sampling and detection.

[0067] The primers used for quantitative PCR are:

[0068] OsMYBS1Q-F:GGCTGGACAAGTTCGGCAAGG(5'-3')

[0069] OsMYBS1Q-R:CGGTCGCGGTTCATGGAGT(5'-3')

[0070] Analysis of tissue expression patterns involves extraction of RNA, reverse transcription, followed by quantitative P...

Embodiment 3

[0102] [Example 3] Subcellular localization of rice OsMYBS1 gene

[0103] Primers were designed at both ends of the full-length ORF of the OsMYBS1 gene, and NcoI restriction sites and protective bases were added. After the amplified fragment was recovered, it was digested with NcoI enzyme and connected to the vector HBT95:sGFP(S65T )-NOS, the positive clones were sent for sequencing, and it was determined that there was no mutation in the forward connection to extract the plasmid, and the vector was successfully constructed, and then the constructed vector was transformed into onion epidermal cells using a gene gun. The specific process is as follows:

[0104] First, weigh 30 mg of gold powder with a diameter of 1 μm, put it into a 1.5 ml centrifuge tube, add 1 ml of 75% ethanol to vortex and shake for 15 minutes, centrifuge to remove the supernatant, repeat this process twice, and then wash once with 1 ml of sterile water. Finally, add 500 μl of sterile water to resuspend an...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of plant genetic engineering, and particularly relates to a rice transcription factor gene OsMYBS1 as well as an encoded protein and application thereof. The nucleotide sequence of the rice transcription factor gene OsMYBS1 is shown as SEQ ID NO.1, and the cDNA sequence is shown as polynucleotide of SEQ ID NO.2; and the amino acid sequence of the encoded proteinis as shown in SEQ ID NO. 3. Through overexpression vector construction and agrobacterium tumefaciens-mediated genetic transformation, the OE-OsMYBS1 gene is transferred into a japonica rice variety:Hejiang 19 (H1493), overexpressed plants have abnormal plant development and brown planthopper resistance enhancing effects, and the main signs are shown as follows: leaves become yellow, plant heightbecomes short, leaves become wide and short, and the honey dew amount of brown planthoppers growing on OE-OsMYBS1 is reduced compared with that of brown planthoppers growing on WT. The gene disclosedby the invention has a good application prospect in gene molecular function research and molecular assisted breeding of brown planthopper-resistant rice or improvement of rice germplasm resources.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering, and in particular relates to rice transcription factor gene OsMYBS1 and its encoded protein and application. Background technique [0002] Rice is an important food crop, and more than half of the world's people use it as a staple food. At the same time, rice is also a hot plant in agricultural production and scientific research. As a model plant for scientific research, after the completion of the rice genome project, its The study of functional genome has received more and more widespread attention, especially the study of some genes that regulate important agricultural traits of rice has been paid more and more attention by researchers. [0003] Transcription factors play an important role in plant growth and development. For example, OsMADS57 can regulate rice tillering (Guo et al., 2013, The interaction between OsMADS57 and Os TB1 modulates ricetillering via DWARF14.Nat Commun.doi:10...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/82C07K14/415A01H5/00A01H6/46C12Q1/6895
CPCC07K14/415C12N15/8286C12N15/8261C12Q1/6895C12Q2600/13
Inventor 马银花段仁燕陈乐金晨钟黄敏毅
Owner HUNAN UNIV OF HUMANITIES SCI & TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com